Description :
From Genome Similarity Track
Location :
Scaffold_137:3516- 5912
Sequence
2396 bases(100 bases per row)
GCTGCGAGAAGATGACCGCGCGCTGGATCTTTGATCGCCGATCTTGGAACCTAAGCACCACAAACAAAGGGGTCAGCTACATCTTCAACACAAGTAGTGA
AGACCGCATGATTGCCAAGGTATTGAGTGGATACAAACCAAAGGACGTTGTCCCTCTCCAAGACCTGTCCAGCTTTGACGCCGACACGCTTGACACGATT
GCCGAGTTCCAACGAGTGTGGTTTGCAGCTTGCTATCAAATAGAGACGGAGAGGTTCAACATCAACCGGAAGGCTCTAGATGTCCTGACCGCTTGCGTCG
TTAGGCGCTACCCCGTCAAAAAGGGCTTGAATCCCAACAGTCCAGCCGTGCATCAAATCGAAACCTGTGTTACGCAGGCGGGACGTACGGTTACGGACCT
CTTAGCCTGGTCGACGCATCTTGCAGAAGCGCAGCATTCCTGTAAAGACAACATAGAAGCATCCACCTCACCATCCATGCCAAAGAAACCAAGCCAAGAA
TAGAAGATCATCGAGCACCAGGCCTCTGTCATTAAACACCTTATGAGAATATTCCAAGCGCCAAGACTCCCGCATGGATATGATTGAGGCTAAGCTGAAC
GGTGATCCTGTAGCTGAAACGCGAAAAAGAAGCATTCAAGATGAAGACGCCACAGATGTGAGGAAACCCAAGCTAAAACAGCGTAGAGGATCAGCTAACT
ACCTTCATGCGACTTAGTTTACCTGGTACGCGCAAGGGCCACGCTGGTACGTCGAAACACCGAAGTAGCAGCGCTCGAAGGCCAAGCTGCTAGTCGCTTA
CATGAAGCTTTCTTCGACGACGGTTTCGTGCTCAGCCAAACCTCAGCGGACTACCGCGACCGAGTTCTGGAGCTGGGGAAGCGCGTCGAGAATGCCGTAC
TCAGGTACTTGAAAGTCAAACACAGCATCAGCTCTCGCGGATCGAGCGCGGTCCTCAAGCTCCTCCAGCGGGTCCACTGCACCGGCGCGCCAAATGCTAA
GTTCCAGCGCCACCGCTAACTGCTCCAGACAGCTGCAATCCAAGACCCGTATCCTGGCTATACGCAGGACGTTCTTGAGGAGGTTAGTAAGTGGAACAAG
CATTTAAATGAGAATGTATTCACCCTTCCTCACAGCATTAAGCTATGCCGACCTCAACACACTTATGCAGTCACCTTTCTTGCTGATCTGAGCTGTCCAC
GAAACTTGATCTTTGCTACAAGGCCTCTAGCCCAAGCATAAGCAATAACGATGATCCGATTTGAACAGGCATCCTCAAGGCCGAAATTTTGCGCTCTTCC
AGTTAAGCTACATCGTTGGAAGGGGGGGGGGGTCAGAGGCGACCTGGAGGCTTGGAAGACCGTGCAGCCCGTACGGGAGATCAGCGTGGTTGCGTTGAAA
AAAGTAAGACTGGCCGCCAAAGTGAGCTGTCGGCGACGGATTGACTGAAAGTGAGAGGATGCAAAACATTTAATACGTGTATTCTAACGCAAATAAAAGT
GGCACGTTTTTACGGGCAGATATTTAACCAATAAGCAATAGTAGCTCTGATAACTGGCTGTCGCCAATCTTAATTTACCGGACAGATGCAAAATTATCCG
GACGATCGTGGCGATTCTGCCTTATTGTTGAATATACTAACTCATACGCACGTGACTCTCATGCCAAAAATGCATAGAAAAACAAAATAGTGATTTTCTC
AGCCCAGAGGGCGTTTCAGGCCATTTCCTGCCGTCTATAAAACAGTCTGTTTGACCACTCTTTGGCCTTCAGCGTCATTTCATATCAGGCATGCCCTCCC
CTAAACCTCGTACATATCTGCGATAAGCTGTGTACAATACATAGGTCTGATAAGGTCACCCGGTCCGATAAATTTTGGTATGGCAATTAATTAATTTCGG
AAATTTTTGTCGATGGCTACGATATAAAGCCAATTCTGATACAAAATCTCAAAAAAGATAGTCATTTCACGAAGAAAAATATAGCGAACGATATATACAA
CGGCATACGAGCTTAAATGTCTAAAACGATTTAATATCCGAGCGATTAAATGGGGAAGCAGCTACCGAGTTAAGGTTAGCGGTAGGACCGGTAAGATGGT
GTATGCGAGAAACTTATCGCGCCTCAAAAACTTAGAGCTTGTAGCGAAGCTGTACAAGGTCAGTCTCAAGCGACTGGAGAATATCTTATCCCCAGACTAT
CAAACTGACCCTCACTATCGCTTTTTCAGGGGCAACCACATGATTTCGCACCTATACGAAGGAACCCACCGTAGTGAGTTCTATGACAAGCTTCACCACG
TTCTTGAGAGTGAGACAAGTGCTTACAAAGTTAGCATAACCCTCGGCTATGACCTTGTTAGCAAAGCAGATCATTCTGATTCGAGATACTTCCACT