Description :
From Genome Similarity Track
Location :
Scaffold_1615:3516- 4863
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1615-snap-gene-0.3Adherance factor

Sequence
1347 bases(100 bases per row)
TGTCGGTCAATTCGCCATCTTCGGGCTCCTGGTCGTTGTTTGCGCGGCGTAATTGGTGGTGACGGAACGCTTCGATCGACATCGCGAGGTCCGCTGGACT
CCCACGTCGACGCGATGTGAAGAAGTTGCCCTTGCGCATAACAAAGCCATCGCTCAGTGAACGCATGGGGAAGTTCGCCTTGGGGATCTCGACGACATCC
GGGTTGGCCGAAAACGTCTTGTGTTCCATCAAGCGATTGCGCACAGGCTCCAAGAGATCATCATACGAGCGTCGCTTGCCGTTAGAGAAGCTCTGCGTGC
GAACCACTGGACACGGTTTCCCAGGCGAGCAAAGCGTCTCGCTGCCATTCGAAGAAGCAACGCTTGTCGAGTGGGGGGAAGACTCGTTTCGCGAGGTACG
ACGCACTTCAAGCACACATGCCGTGCACACGCGAAGCTGTCGCTCACCATGGTCTGGGATATGAGCCGCTCGAATGCGGCTGCAGCTACTACAAATCACT
TCGCCGCACTTGAGGCAGTTGTACTTGCGGCGCAGCACGCAGAAGTTGCGCTCGCACACGTGGCAATGGTCTTGCTCGCTCATGGGAATCACCTGTTGGG
GGAGAACGATCGTCTCTTTCTTCGCACGGAACGTCTCAATGTACTTGAGGATCCCGTTGATGCACTTTTCAACATGGGATTGGATGGCCGAGTTCGCAGC
CCACGCTGGGAGGTCGCCATTGTCAAAGTTGCACGTGTACGTCATGCGCAGTTCGCCTTGCTTCTTGGTCGTGTGGTACATGAATCCCATGAGCGGGACA
ATATCGCGAGTGTACTTGGGCGACTCGGCGTACTTGGACGACGCGGGCACGTCCACGGACTCCATGATCCGGAACGCAACCTTCTGTCCTTGGTCATCTT
CGATCATGTCGACGTACTCCAAGATGATGAAGTCGCGGTCCTTGGTGAATTTGCTCGAGCTCTTGAACGCGGCCCACTTAAGCGCAACGTATCGGTGTGG
GTTCAGTTCCGTGGGCTCAACAATGTTCTCAATCACGGCGCCTTCGATGAAGTCCGACGAGAGCATCTCCATCATCTTTGTGTACGACTCGGTGGTGCTG
GTGATCATGGACTCGGCGATGTCCTCAATCTCACAGGTCACCTTGCAGACTGCATGCACGTTGCAGGGCACGTTGTTGCCGACGTCGGCGCGGAAGAGCG
AGNNNNNNNNNNNNNNNNNNNNNNACGAGGCACCATGGGATACCGCCGAGCAGGTCCGTGGCTTCCAGGAGCGACTCAGTCATGCTCTTGGCGATGGTCG
TGAGGTGCTCCTTCTCGCGCACGCTCATCTCGGGCTTGACGGGGTCG