Description :
From Genome Similarity Track
Location :
Scaffold_33:351447- 352899
Transcript NameFunction/comments
Phyci_6428Hypothetical protein

Sequence
1452 bases(100 bases per row)
TTAATAGACTAATATTACCTGTGTGCTGGGGACGAGATGGCCGGGCCTCTCGTCGAAGACTGCTCCTTCGAACGGAGCTGGTTGATACGGGACAACACCT
GCTGCCGACGCTCAGCAGCAATACTAGCAGTAGCGTCGTCCTCGCCGACATCATTCAGATGCGGTGGGTCGGTGCGCCACCACTCGACGACGACGACGAG
TTCTTGGACCGGTGGCGGCTCTTCCTGTCCGAGTGCTTCATGGCCGAGTTCAGCGCGTTGAACGACTTCTTCGGCACTCGCCACCCGGATCCGTCCATGT
ACACGTCGTGGTAGACGTCCGGGTCTCGGAGTCGAGGACGGTCAACCGACAAGGTCGGTTTCGCCGCAGCAACGGCTGCAGCTGCAACTGGAGCAACCGA
GTGGGTCACCGGCACGCCAGTGCCGTGATGATGCACCGTATGCACCTCGACGGGCTCGTCCCGATCAAGCTCACGGTGGGCTTCCCGGTCATAGTACCGT
TGCAGCGTCTGCCGGACCTCCTCGCGCTTGGGGTCCTCCTGCTGGACGACGCGGATGCGCTCCATGGAGGAGGCCTCCTGGCGCCGCATGCGGTCGTACT
CCTCGGCCTCCTGTGCCTGCAGCTCCAGCGCAAAGGTGTAGTCCGGGTCGTCGTCGTCCTCGCGTGCGTCCTCCACCGTCACCTCCTGTTGGATGACGCT
CATGACGCCGTGGCCCGAGCTAGAGCTCGGCACCTCCACGAAGCACCAGCCGGTCTGGCGGTCGTCGCCACCGAAGCGGCCCTCCATCTCGCGCTCCCAC
TGCTCCTGCTCCTCGCGCTGCAGCTTGGCCGCCAGCTCCTCGTCCATCACGTCGTGCAGCTTGACGGCCACGGGCGACGCGGCGGCCGCCACGGCGCCAG
CGCCCCGACCCGGTCGCCCCCACGCGCGTCCTCCAGAGCTCATCGTTGGGCGAGCGTTATCAGAATAATAATATTGGGATTAAAAGGAGGAGAGGAGCTT
GGGCCAAAAGACCTCAGCGTAGTAGGATAAGCAGGCGGAAGGCTCGAGCCCTGGTGGTTGATGTGTGTGGGTGCGTTGCAGCGCGCAGATGCAGGCCTGC
CCCCTTCTACAAGGGCCAATAGGCTCTTGTACAGAGGGATTGCATGCATTCTGACCAGTGAGTGAAGGTGCAGAAATTGGAGCGCTGTGAGTGGCTGTTT
TCATGAGATTGAACACGATGAATTCTGCAAAGTGCGACATCAGTAAGTACGTGCGAACCACTCGGTGCTCTTTCGCGTACCGCACGCCAGTCGCGTCGCT
GACGCAGGCGACAACGAACATGGCTGCACCATCGGCAGCGGCTGGATTGTATGCAGTGGCGTGCCGCGAAGCAGCAACGGCGCTCGGCTGTGTAATGGCT
CCGTGTTCTTGAGTCGTTCGCGTCGGGGCGTCGCGGAGCCGCTCGCCAGCAA