Description :
From Genome Similarity Track
Location :
Scaffold_39:351428- 356736
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011955Similar to Chmp5: Charged multivesicular body protein 5 (Mus musculus)
Pytul_DAOMBR144PYU1_G011954Similar to ARL2: ADP-ribosylation factor-like protein 2 (Bos taurus)
Pytul_DAOMBR144PYU1_G011953Similar to ypgQ: Uncharacterized protein ypgQ (Bacillus subtilis)

Sequence
5308 bases(100 bases per row)
CCAGACGGCGCAGCAGGGAGGTTGTGCTGCGGTTGTGCTGGCGCCAAGTACGACGGCGCTGCTTCTGCGGCGGCCGCCTCGGTCTCTTCTTCGGCCCATT
CCTCTTCGAGACCGGCCAACTCGGCTTCTAGTTCGCTCTCGTCGACGTCGGCACCAATGCTTGGTTTGGATAATAGTCACGACAAAGCACACATCAGTTA
GTCAATGCAATGGCACGCATTGCGCGAGCGAAAAATACTTTCGTTCGTACCCGTAGGATCGTCCCATGATCTCCTGGATCTCATTCATGTCCTCTAATAA
ATCCGCCATGTCATCTTGCACGTCCTCAAGCTCGTCGATATTGATCTTCTTGGTCTCGGTCTTCAGTTGCACGACCGCGCTTTTCATCGCGGCCACGGTG
TCCAACGTATCTTTTGAGGTCTCAATCGCAAACGAGGCCTACATGTCAAACGAAAATACCGGTTCAATACTTCGGAGCTGTTTCCGCATGTATAAAGATA
CAGATGCCAAATAGGATTCACCTGCTCAATGTTGAAGGACTGTGCAGTCAGGTTGTCGCGCTGCTGCTCGTACATTTTCTTGCGCTTCAGCGTCTGCATC
GCGCGCTGCTTGATTACGTTCAGCCCTGGACCTTTTGTCTTGGCCATCTATCGCCACGTATAATTTCAGTATTATACACCCTGTTAGCCCTTATAGCATT
GCTATGAACGCACATTCAAGCACATCTACCACATATCCGCATAGACGCACATACCTGAAGCTTGTATTTCTTCAATTCTTCATCCAATTTACTAATCTAA
GCGCACCAAGAGATCAAACAGCGAGAGCATATATGCATCAGCACTTAGTGTCTCACAATAATGCCATAATCGGCACATATATACACACAACATGGTGATA
CAATAGACGCATCATATCCCCATGCTGTTTACTGTGCTCCCAGCCTTGGTATCAACATCAGCGTACCTTCATTTCGAGATCTCCGACGCGGCCATCGACG
CGGCCGCCGACGTCCGAGATGTTGACTTGCGGCACTTCAGCCTTCTTTTTCCCAAAGATGCGGTTCATCCTGTAGTGCAAATAGCGTTTGCTACTGCCTT
CCTGCTCCTCTCTATGGTGTTGAGCTTCACGCGCGCGTCCGCGTTCTTCTTTCTCTCGTGCTTGTCCGCTTTTTCGTGAATGCCAAGAACAAAATGAAGG
AGACGGGCTACTATTGTGGGTACCAACACTTTAGAGTCCAACTGCGACTGGGTACACAACAGCCGCCCAAACGAAGATGTGTTTAGCACCGAAATTAACA
GTCCTATTGATATACACACAGTGTACGGAGTGCAGCAGACACTTAACCCAATTGTGTATTTTGGGTACCAACGTGGCTTCAATTTGGTGATCCCATGCAA
TTGTATTATCAACAAAAGACACGCATACGTCACGAAGATGGATACGCATTCTAGATTCATATTAGATGCTCGGAGCCGACGATGAGGACGCATTGCGGCG
CAGCATGCGGTAGATGCTGCCGTGCTGGACCTTGCCGAAAGTGATGGGTGGAGATCTCTACAGGTGGATAGAAAGCTTATGTCAGCGATGGAAAATGCTC
TCTGTCCTTGCGTCAACTGGTACCAATCACTGACACGAGTACCAAACGCACTCACCTTAGGCGTCGACCGAGCGCCTGGGGATCCTGTTCAAACAAAGGA
CGCAAACATGGCTTGTAAGCACCTTGACACAACAAGAACTAGAAAGTACGTGCAGCGGCCGTTACCTTCTGGAACTTCTGGACTCTTCTTGTCATCTACG
AGCACTGGCTGGTCGACTTCACTACTTCGATTCTTCAACAGCAGCGAGTAAATGCCGCCGTGTTTCACCTTGCGTTTGGGCACCGACGCGGCGTGGACTT
GCTGCTGCTGCTGCTGAGGACGATGCAGAGCTGCTGCTGGTGGTGATGGTGAGCGCGCGAATGCAGAGGCGAGCCCTTGAGATGGAGATACGCGTGGATT
CCGTGATGAAATGCGATGGTCGGGTTTCGAGACGCTGAGAGAAGGTCTCCGTATGGTCTGTGAATACGGTACTGTGTCTCTCCAGGAGACATCATCCTCG
CCATCATCTCTGTCGTAGTAGTGTAGGTCTGGAGCGGATTCCCAACGAGCGACATTCGTGTGACGGCTCGCGGTTGGCGTGTCTGGCAACGCGACGGGGG
ACGCGAGATCGTATTCATCGCCATCCGCGGAGTGGCAAGGCGAGGGTTGGAATGGCGCAATGTGTTGACTTGGAGACGTGAGGTCAGGCACGCCAGCAGA
AATGGCTTTGTTTAGTTTTGTATCGCATACATAAATTCAGAGAGTGGTATGAGGTCATTACATGTCGTATCGTGTGGTCTATTCGGCCCAACTTACTTGG
GTGGAGAGGTATAACCGAGCTTTGAATCAATGGCGCTTTCGTTGCAAGTAGTGCATTGGTCGTCGTGGTCGTATCAGCATCGTCCCATGGCTGGTGCTCA
CCATGCGGGCTCTGCAGTGCCTGAGGATGCAAAAGAGAAAAAGAGTATGATGGCGTCAATACAACGTTCGTTTGCTGTTCATGTATATGCCCACACGGTA
CCAGTAGCTCCAAGGACAAGGCACAACCCATGGCCCCAAACCCGTCGCTGCACTGCTCGTGGATCATCGCAAACTGGTTGTCCTCGAGCGCTGGCAGATT
GCGCACGTCGAGCTCTAGATCGAGCAGCGCTTCCAGCGGCGTCGGGCGATCTCGTCTACGCTGCTCTTTCTGCTCTTGCTCTCTCTGCAAACCCATGTGC
GCATTGCCGTCGTCATGTCTACCCATTGACACATTTTCAATCGTCTGCATGTTGCAACCAATCTCCTCGCCTTCATCCCACTCGGCACTCTGCATCATAT
CGACCTCCACCATAGCAGCGCTCTTCGTGGGCTTATCACCGTCATCGCCGCTTCTACGCTTTCCAAGCATACAAGGCAGCACCAGGTCTTCTTGATTGCC
TCGCCCTGAGTCCTGGCGCGTCGCAAAGCGGTTGCTTCGGCTTCTACTAAAGAACGTCATGGCGCTGCTGCCGCTGCCGCCGTAGCTACTGCGTCTCGGC
GCGCTCGTCACGCTCTCCTTCGTCATTATACTGAAGCTCTCTCTATCGCACGCACACAGCGCTTTTTCCTTCTTTCTCGCGTAAATATGCCCATTCGACG
CGAACCGTCGCGATAATGGTACCAAAGTATCAAAAACAGTGGTGTCAGACTCAGAAGACACCCCGAATCAGCTTGATACTTTCCACATTGACACCAAACA
CAAGCACACAAAAGAAAGCAACATGGGGCTGCTGAGTATCTTGAAGAAAGTGAAGGAAAAGGAGAAGGAGATCCGCGTGCTGATGCTGTGAGATGACCAT
CTACATGTTGCGTTGCATGTGTAGTATATCGCGTAATCTATGGGCGCTTAACTGTGTGCGGCTTGCGTGCTGTTGCGTGCTGCTAGTGGACTGGACAATG
CGGGCAAGACGACGATCCTGAAGAAGTTTATGGGCCAAGACATCACGGAGATCTCACCCACGCTCGGATTCGACATCCAGACGCTCGAATACAAAAAGTG
AGCCGTGCTGCTACATGTGGATAGTGCGTACAAATCATTCTGACGCGATGTAATATTGGTATTGCGCACGTGTGTAGCTTCAAACTCAACGTGTGGGATG
TCGGCGGCCAGCAAACGATTCGCTCGTACTGGCGCAACTACTTTGAACAGGTACACTTTGTGTATACGACATGCTCACTGCTCTTTACTTGCTCATTTAT
ATCATGCCTAATGTGTCTTGCATATCTATATAGACTGATGGCCTCGTGTGGGTCGTCGACAGCGCCGATCGACGGCGTCTGGACGACTGCAAGCGCGAAC
TCAAGCAGCTACTTACACAAGAGGTATCAATTATTTGTCTACCTATCTCTTTCCCATAGTATACTGAATCTCATGAATGCAATCTCTCATGCTACCTCAT
GGTTTGTAGAAACTCGCGGGCGCGACGCTGCTCATCTTTGCGAACAAGCAGGATCTCCCAGGCGCGCTCACAGCCTCGGAGATCGCCGATTACCTCGAGC
TGCGCAGTGAGCAGTTTGTGAACCGCCACTGGAACATCGTCGCGTGCAGTGCGGTCACAGGCGCGGGCCTTCTTGAGGGCATCGACTGGCTTGTCGCCGA
TATCGCGAGCCGCATTTTCTTAATGGAGTAATGCCGTAATAGCAATCTCAAACTCTAACCCGAGACTCTGTCTTGATCGTGTTCGAACTCGTCTCACGGT
GCATGACGCCAACACATTTCACCGCTGACAAAATGCCTGCATTAACGAGCATAGCGGCATTTCGGTCTGCGATTTGCAACAAACAAGGCGAACTTTGGAT
AACAGCCTTGTAGAGCTCCAATTTGCTTCGATTGATTCATTCGTGAGGTTGCGGAGGCAGCTGCTGGTATCAAGATGTAGTGTCGCAGTTGGATAGTAGT
AAGTGGTGATACTGACCCTCGCAGTTGCAGCTCATAAAGTGGGGTGGCCACCCTGTTTTTAAAAGATTGGTTGACCTCCATGTGTGCATGCTTTAGTGTT
TAGTGGATCCCAAAATGCGTGGCCAGACGTGTGAGATTTAAACTGATGGTCTCACTAGGAGAGGCGCCAAGTGCTGAGCACCGCGAAGACCCAACGGACC
GCAGATGAAGCGGCTGGCTCCTTTTCGGCACCTCCTTATCTCCCAAGCTCACTTTGCGATTCGCATCGATATCAACAGAGTTATTATCTATCACACTCAG
CACGGTGAGCACCGCAGTGAACTCTCCGCTCGTCCAGCAAACTGCCGACTTTGTGCGCGAGCAGCTCAAGTCGAACGACGCCTCGCACGACTGGCGCCAC
ATCGAGCGCGTATGGACGCTCGCGCGCACGCTCGCCAAGGAAGAGGTGCGTTATGTGTATACTCATGGTGTCCTGAGTATGCATACAAGATGCTGACTAT
ATCATAATAATGACAACAGAACGTGCCGGAGGAGAACCTCGAGATCGTCGACTTGGCTGCGCTGTTGCACGACATTGACGACTGGAAGTACCAGACCGAG
GACGTGAAGACGAAGCGCGCGGTGCAGTTCTTGGAATCGCAGCAAGTGCCAAGCGAGAAGGTCGCGCGCGTGATGGCCATCATCGACAACATGGGGTTCA
AGGAAGAGCTCGGCGGAAATAAGGTATGTACGTGTTCTGGCGCATCGACACAGCGCCTGCATAAAGCGTCGAGCTTTTATGTTTTTCCTCATTCATATTC
TCCTGTAG