Description :
From Genome Similarity Track
Location :
Scaffold_13:351345- 353606
Sequence
2261 bases(100 bases per row)
aagcttggacaaggacacccgaaacagattttcgatcctcctcattattggcccagtctgcatccgtgtatactcgaacaggtgctgcattttcacttcg
gcgatatacaaggccccaggctttcgttccttcaatgtagcgcaatatgtttttcaccgcaacccagtgctccttcgaagggtttgatgcatgtgcacca
actggattgacagcaaatgcaatatctggacgtgtcacacgagctaagtagaggagagcacctactgcttgtcgataagtgccttgatctgcggcttctt
GGTCTGGTGCACGGCTGTACAATATGGTTACTTTGTCAGGCGGACGTTTTCGTGGTCGACACTGCTCCATCTCGAAACGACACAGCACTTCCGAGGCATA
TTGCGTTTGATCAAGCGTGGTAATTCCGCGAGCAACGTCCATTGAGATGCGAATTCCGAGAAACCATTGCACGTCACCCAGGTCTTTCACTCCATACTTG
GCTTGCAACGCTTGCATGACGTTCATCATTGATTGTTCATCTTTGTGGCCGATTAGAATATCATCTACATAAATCAACACGATCAATTCGTTAGTAGGGT
GAATGTAAATACAGGCATCTTCGCGAGTAGGAATAAGTCCATAAGCGACGAGAAACTTGTTTAACTCCACGTTCCACTCCCGCCCAGTGTTTTAGGCCGT
AAAGGGCTTTCTTGAGTCGCCAAACCTTGGTTCGACTCCCCTCTTCGAATCCGTGTGGCTGTCGTACATAAAGTACTTCAGTCAGCCCAGCCTTAACGTA
CGCCGTGGGAACATCATCCTGGCGTACGCGCATGCCCGTTGGGGTCGCCATTGCAAGGAAAACACGGATGGAAGTTAATTTCGCCACGGGAGCGTACGTT
TCGTAATAGTCTTTCAAGGACTCTTGCGTAAAGCCCTTTGCACATATTCGAGCTTTCAGGCGCTCGACTTCCCCGTGTGCACTTAGCTTCACGCAAAAAA
CGATTGTCGATCCAATGATATGGACACCAGGTGGTGGGTCAACCAAGTCGAAGGTGTCGTTCGCTTTCAGTGCGTCAATTTCGTCACGAATAGCTTTTCC
CCACAAATGCCACTCGGTGGATGCTCTGACAGCTTTAAGATTCACAGGTTCTTGAATGATTTTCCGCAAATGAACCTGCGCAGCACTTAATGCCACACTG
GTTGGTAGGTTGACAATTCGGCGAGAACGACGGGGTTCAAATGGTGCTGAATTGTCAGTATATTCACTCAGCTGAGTAGAAGACGAGGGCTGTATAGTAG
AGGTTGTCACATCATTTTCGTCATCAAAAGTAGGTTCGTCGTCACTTTCTTCAGTGTTGTCTTCAACAATCTGAAGAGGATCATCGCGCGGGTTTGTTAT
ACTTGTCGACGAAGGAGAACTTGGTGGCTCCAAAAACACACCACTGCGACTGTGGACAACTTCGCGACTGCGACCCGTTATGTAAACAAAGAAGCCTTTG
CGTTGTGGGTCACTGCCGATGAAGACGCCACTCTGTCCTTTTGGCCTGAATTGATACTTCGTAGATCGATCTCGCGGTGGTATCATTACCACACAGCGCT
GCCCGAACGTCTTGACAAGCTTGAGGTCGGGTTTGCGTCCCCAAAACTTCTCAAACGGCGTCGTCGTGGTGTCAGAACGTGACAGGACACGATTTCTCGT
GTGCACAGCACTTCGGACGGCGTATTCCCACAGGTACTGGGGCCGTTTAGCACAAAGTATGAGTGAGCGTGTTGCGTCAGCAAGTGTTCGATGCGTTCTT
TCAATTACGCCGTTTTGATGATGGACTTCAGGTTCGCTCATTTCAGTGGCCAAACCCTCTGCTGCACACACTTCGCGAAAGCCATTAGCTAAAAATTCGC
CGCCGTTGTCCGACCTATAGATTTTTGGGCCTTCCGTTCTGCTGAAGCGTCGATTGACGATGTTCATGTACTTCTGGGAGCATGTGGTAGCTTCATCTTT
TGTTTTCAGGAAGTACACGGTAGTGTGGCCTCTCCACTTCAGCGCGTAGTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN