Description :
From Genome Similarity Track
Location :
scaffold_345:35132- 37159
Sequence
2027 bases(100 bases per row)
CACTGTGTGACGTCGATAAATGCGCGATTCCTGTTAAGAAATGCGCACATGTCAATGTTGTGCGGCGAGAGGGAAGTTCGTTGACACGTGACCATCATCC
CGCTAACGCTGAAGTCACGCTCAATTTGGGCCGATGATGCTGGCATTGCGTAGACAATGCGAGCGACTTGGGGTAGACACTGGTAAATACCCCCGTCAAA
CATTCGTTTCCAAAAGTGGACGACGGTCTCAACATTGTTTCCAGAAGTAGTGGCCAACAGAACGGGGTCACTAAACCAACGCTCTAGCTCCTCATTCACA
CGACCTTCGAGTAGCATCTCAGGAGTTGATCGTAGAGGAACAGGAGTAGACGAGAGCGGAAAAAAATCCGCAAGATCCTCTGAAAATCCTCCATTGTGTT
GCGCGGCAACTGTTGTTGGTGCTGGAGCCTCTGCACAGGAGGTTGCAACGACATCATGATTGCTTTTAAGCGATCAAGGACTGTTTACTTGACAGTCGTC
TCGTTTCGCTCGATAACAGATTCGCTGAGGCGCTGTGATCTACCGCAGGTTTCCACTATGCCCATCAACATGCCGTCGATATTTTTTGTGTGAGGATGCA
GCACCATTTGCATTTCTCACACAAATCAGCACGTCTTCATTTTTTTCTCGACTAGTGTAGCGTGAGAAGAATCGGGTGTGAAATGACTGGCTTAACAAGT
TGCGGGTAGTCTCGGCCAAAGGAACCAGCTCGGTTGGATGATGGTACACAATGTGTTCTCTTGTCGAGTCATACTTTAGCAGAGGTTGGTCCACTGCCAG
CGTCGTCTTGTACAACTTGTTCGCAGACAGGAGGACGTCCACTTGATTCAGCTTTTCGGCTTGGCTCTTGACATTGAGTGTGGACACCGGCTCCAGCAAA
GACAAAAGCTGCTCCATCTCCAATTTCCAGCCGGCCAAAAAAAGGGGCGGGGCGGGGGGTTTCCTTCGCGCTCAAACTTTCTCGTCCTCTCCTCATACCA
CATCTACAGAACCGCCCAGTGTTTGAGAATCCGCTTGAAGACTGGGGTTAACCCCATGATGCGGTGTGGCCTGTAATCCATCAATTTTCGCTCCTTGCCA
AGGCCCAGCGTAGCAATTAGCTCTGCATACAAACTCCCTATCACCTCCACCGTGCGCACTTGATAGATGGTGGCAGTAACCTTGCTTAATAGCTTCCGCA
TGCCAGGATTTTTGGACCTCTCCGCATCACCAGTCATACCAACAGCTGCCTCAGTGGCTGCATTAGTCAAGTGAGGCCAGCACCACTCCCAGTTGAGATG
CAGACCGGAATACATCATCCATTTCATATCAGCGCCGCCATCGGTCGTTGCGCCAAAGAAATCCAACGTTGACAGTTCAAAGTCTTGTAGGAGGTGGTTG
ATCCAACGGGCAAAAGGTTCACGAATCCCTTCGTCTCTCTCGCCGTACAGTGGACGAAAATGGCGGGTGGCCAGCAAAATGGACCCAAAGTTCCACTTGG
CCTCGATGTAGTATACACGAAGCCCAAGATACTTTGTCCCGGTTGTCTTGCATGTCCAAAAATCGGTCACCATGACAAGACATTTAACGCCACGAAGGCG
ATTGAGCCGCAAGAAGTGAATCATCTCGAATTTCGCCGACGAGTACAGCTCGATCACTGAATGTGTCACAGTCTGTCTGTTCACAATCGCTCGGAACTCC
TCTTTTGTAATGACAGCTCTTAACAACTGGGATTCCTCCCACTCGCCCACGACGAACGGCAAACTGTTGTGGACGGTTTGCAGTATTTGTAGCAGCAAAC
TGATACGCTGGCAATTTTGCTGAGACGTAGCACATGCCAAAATACGAGTAGCTTTCTCGTCTCGTGACCGCATGTGTGTATCCTCAGCAGCTGTTTTTGT
TGAAGTAATATCATGAGTGTCCTTTAAATGCTTTGTAGCACGCGATGTTTTCCCACCGTATAGGCCTTGAATATTTTCTGCATCCCGACAGGTCTGTGTC
GCTAGACAAATCCAACCTTGAGAAGAC