Description :
From Genome Similarity Track
Location :
scaffold_37:35122- 38842
Transcript NameFunction/comments
Pl_111488hypothetical protein PHYSODRAFT_543861

Sequence
3720 bases(100 bases per row)
ATGGACACCGAAGGCTTCACGTCACGCGCGTGGCTGGGCCACTGGGTCTCAGGCGAGGAAGAGCCTGTGAACAACTACTACGAGGACCACAAGCTCATGG
AGGGTGCGCTCATCAAGCTGGGCGACTACGCGCACTTTCGCTACTTTCTACTCTTTCGCAACGGCCGTTTCTGCTACTACGAACTGCCGATGCCTGCAGC
AGCGCCTGGGGGGGGACCCGAGGGTCCTCGACGCGTGCATCTCACGCTCACGTCCAAGCACCTACGCGGCGTCATGATGCTCAACGCGTCAGTAAACGCT
AAAGATTTGGCCAAGAGCGAAGACGAGTACGACGCCGATCTCATCAAGCGCGGCCTCGTGTTCAACCGGAAGAAGCTGGAGATGCAGCTCACGGGCTACT
CGCCCACGGGGCAACTCATGTGCTGGAAGCTTCGAGCTGGCAAGGACGCCGTCTACCTCAAGTGGGAACGCGCCTTTCGACTCGCATTGCGACCCATTTG
GGTGCAGAACTCCAAGTGCTGTATGGTCTGCAAGAAGGAGTTCAGCTTCTTCATTCGTCCGCACCATTGCCGGTACGTTGCACTGATTAGTGCCACTCTT
TTGCAATAACTAGAAGTGATATTGACGTGTTGTTGTTGCAGTAAATGCGGTACCTGCATGTGCGACGAATGTTCGGTGTTCGTCCCTCGACTGCCGATGC
AGGGCTACTATGATGAAGTGCGGATCTGCCGAGACTGCTCGCCGATCAAAATCCAGCGATCGTCGCTAAAAGTGGGCACACGCGTGCTAGTGTGTGGTAT
TTTGGTTGGCAAAGTTGTACAGGTCGATGCTGCTGATGACTCGGAAGATGGGAGGGCGTTCGTAAATGTGGAACTCAAGAAGAAGGATAACCAATTGCAC
CGGTTTGCACTGGAGCATGTGGAACTCTACTCCGACGCGGTGTTATCGGCCAACCGCATTAAGAATGCTATCCGCCAGCATCTCTCGTATACAGTGTTTC
GGACGCAGCTCAACTTTAACACATGGAATTTGATTGAGACCGTTCAAGAACAACGCACAGTGCAGATGGTACGAATACTCAACAAGTCAACGAGTATTAA
CGAGCTGCACTCGATGGTGCCGATGCTCGGCTCGTTAGACGCGATGCAGTTTCCCGACGATGACGTCTCCGAAAAAGATCGTGTGAAGGAATCCCTATCC
CATTATCGCGGTGTGCATGTGTCATTTCCGTTGCGGCTGGACACCGTGAAAAGACTGATTAATCAGTTCCGCAATGGCATCTTGTTGCACCGAGTGTTTG
TACGCCAGATTTTGGACGAGTCTGAAAAGCTTTTTCGAAAGATGCACGAGTCGCCAATGAACGAGATCGAGATTCCAATGGGTGTGCAGTTGGTCGTAGT
AGGAGATCTTCATGGGCAGTTGGAAGACTTGCTTACAATTATGGACAAGAACGGTGTTCCCAGCAGTAAAACGTGGTATCTCTTCAACGGCGACTTTGTG
GATCGCGGATCGCATGGAATCGAGGTCATCCTGTTGCTGCTAATATTCAAGCTACTGTACCCTGATTATGTCTTCTTGAACCGTGGTAACCACGAAGAAC
GCATGATCAACGAAGTTTTCGGCTTTGAAGATGAACTATATACAAAGTATGGCACAGACCACGACGAGGTTGCTGGGTGGAGTGGCTTGGGTACATCGAT
GAATTACTCACCGATGAAGCTTTTTCAGATGTTTGAGACGGTCTTCGGTTTATTTCCCCTCTTTGCATTGCTGAATAAGCGTGTTTTCATTGTGCACGGT
GGCTTGAGTAACCACGAGAATGTCACTATCAAAGAACTGCTGCAGCTTGACCACCGACGTGAAATTCCGACACAAGGCACGAGCAGAGCCGACGAAGTGT
TTACGCATCTGTTGTGGAGCGACCCACGTGATGAGGATGGGTGGAAGCCGTCAAGCCGAGGGGCTGGCGTGGAGTTCGGTCCTGACATCACTAAGGCTTT
TTGCGCACAGAACGGAATAAGCCTTATTATTCGGTCACATGAGTGCCGAGAAGAAGGTTTCGACATTGTTCATGATGGTCTACTTCTGACGGTTTTTTCG
GCATCAAGCTACTGTGGTTCCCAAACTAATAAGGGTGCCTACGTTCAACTGGAATTGGGAGAAGACAACGAAGTTAAGCCACATGTTGTGCAGTTTTCAT
CTCAACCGCTTCAGAAACTGAAAGCAGCCGGAAGAAATGAGTGGCGAAAGAAGGCGCAGCGATTGGAACGCAGAACTTTAATGTCTCTCGTGGAGATTAT
TTGTGAAAAGAAGAATGTCCTGCTGTCTGATTTCAACGAGTTAGATACTACCAAGTCTGGACGCGTCACCAAACTTGAGTGGAAGGCAACTTTACAAAAA
GTGGTGGGTATTGAGGCGAGCTTTCTTTCATATTTCCATCAGCTCGCCGAGGAGGAGCAGGATGGTAGAGTTGACTACCAAAAGTTTCTCAATCGCTACA
CAGTTGAGTTGGATGGCGGCAACGTGGAGTGGAGACGCAACCTAATCCGAAAAGTTTGGATGGGATTTTGCCAAGCGCTTCCGCATCCATCGGAAACGGA
TGCTGAAAAGATGACATTACAAGACAAACTTCACTTTGCGTTCAACCTTTTCCAGTCATCTCCCTCTGGAGGTGCCAAAAAAGAATTCGCGGCGAAGCTT
GTTTCAAAGCCCGACGAAAATAGCCCGTCTAGCAGCACCCACTCCACTGGTGACAAGCAAAAGGAAAGTTACTTGCGTAATGGGCCAGTTACATACGAAG
TGTTTCGGAATACTATCCAAGGCAAGCTGCAACTAGGCGACACGCTTTCAGAACAGCAGATCTTTGAGCTCATGCAACACCTCGACCAGAATCACGACGG
TGTGGTCGACTACCAAGAGTTTTGCTCATTCTTTGCTGAGTTCAGTCGCACGGATTATCTGCAAGAAATCTTCGAGGTGGACGACACCAAGGCCATTTCA
CTCCTGAACCGGTGTGCCACACTGTTACAGAGCCCTAACAAGTTCAAGTCGCTACGGGATGCGTTTGACGCATTCGACCGCAGCAAAACAGGAAAATTAT
CTGTCGATGACATTTTGAAGGGGACGCAGGAGCTCAACATGATACCGGAGCTGGATAACGAAGAAGCGCAACTATTGTATAATTCGATTCTGCTCACATA
CTACGGCATCAACCAGCGGCATCAGTGGGATACGCGGGGGTTAAACTGGGTCGTATTCGAGGACACTTTCTCACCCGACAGCACCTTCCAGCGGCGTCTG
TGGCTGGCAAGTCTCGGTGCTTCGAACACAAACCTGGCCGGGATGGATACTCCTGACTCATTGTCCGGGGACGACGATAGTGTCCAAGACGGACAAACGA
AGAACCAAGCGTGGGCGGACACATTCGTCGACAGTGTGAAGCAGTCGTTGCATGAGCAACGTCTCTACATTAAATTCCTGTTCCGGGTATTGGACCGCAA
GCGCCATGGATATGTCACGAAGGAGCAGTTCATCGCAACAATGCAAGCGATTAATGAGGAGCATGGCGCGCCACTGAAGCTTTCGCAGCTGGAGCAGTTG
GCCGACGCATTCGCGCACCGTAAAACTGTGCGACGGATGTCAAATGCAGGTGAAGAGACGGAGGAGACGCGTACATATATTTCTTATCCGGAGTTTCTCC
GCAGCCTGCGAATCATTGAC