Description :
From Genome Similarity Track
Location :
Scaffold_867:3512- 4819
Transcript NameFunction/comments
Phyta_totarag11112hypothetical protein

Sequence
1307 bases(100 bases per row)
ACTCCTCGTGCGACTGCATGGCCTCAACCCGGTTCCGGTTGGCTTGTTCACACAGGTAGTCGTGCAGTACAGCTCCGCAGTTGAGATCGGCTTCATCCAC
CCATGTTGATTCAGGGTAGCACTTCCAGTGCACCAGCAATTCTCGTAGTGCTCGTCTGCAGCGTGATCGCCGTCCCGATCGCATTTCATTGATGCGTTCT
ACCTCGTACTCGTCTTCGCCTAGTTCGGTTTCCCAGCTATCTTCAGGCAACAAGGCCTTATCAAAATCGAATCGTTCTTGACGTTGGACGACTAGCCGAA
GACGCGGACGGTCGGGGCAGTCTTGTACGGGCTTAAGCTTCGACACGTAGATCACGGGGAATAAGTTGTACGCGGTGCCAGCGATCTCTAGTCGCACGGC
GTGTTCGTCGTTTTTCCTGATCACTTTGAATGGGCCGTGCGACATGTGCGCTAGCTTCCATGCGTAGCcttccttcaccttgtccagATGCAGCCAGACT
TGGTTGGTCGATTTTGATCTCGTGCGGACGCACCGAATCGTTATGATGATCTGCCCTGGTTTGGATAGCTTTGCGTGGGTACTCGATCACTTGCTCACGC
ACCTGCTCGTAATGCTTCTGAACATGGTATCGCCACCTTCGAGGGTCGCAATCTTGACGCCGCGTCAATCCTAATGGGGCCATCGCTTCCATCATTTATC
TTGGGTCCCATCCATGCGCCAGATAGTACTGCGTGTCGCCGCGTACTCGATCGTGAGCCGTGTTGAGGGCAAATGTGAGACGCTCTGCATAATTATCCCA
GTCGATATGGTTGACGTCTTCGACGTACATATTCAATGCTCGCGTTAGCGGCAGCACCATTCGTTCAGCCGCACCGTTCGCATGTGGGCGATGCGCCATA
GTCGTTCGCTGTCGTTGTCCGCTGATTTTATTAAACGATCTAAAGATGCCGGACATAAAGCCTGGCTCTCGGTCATGACGGATCGCTTTACTCTCGCCAA
ATCGTCGAAACATACACTTCTCGTCATTCTCCGCAATCGTCTGAGCAGTTCTTGATGCACTTGCCTTGGCGATCACGAAGCCGGTGAAGAGATAGACTCA
TATTAACAATTCCGTGTTGCCTTTATATGATCGAGGCAGCGACGGGATGTGGTCCACAACAATAATTTGAAATGGGTATATCGCCTGCAGGTTGTCTGGC
GACTCACCTCGAACAGTTGGCCGCTCTTTTCCAGTCTCACAGTCTATGTACTGACCCACGCAACGTTGTACACTCTGATACAGTTCTCTTCAGTGGAATG
GGGATTT