Description :
From Genome Similarity Track
Location :
Scaffold_33:351193- 353092
Transcript NameFunction/comments
Phyci_6428Hypothetical protein

Sequence
1899 bases(100 bases per row)
CAAGCAGGAGGCTTGGTCGGGTCCCAAGGGGGAAATGAGCTCCTGGTTGGTGGCAGCACTCCAGGCCCTACCGAATAGCTTGGCGTATGCGCTTGTGCAG
GGCGACAGAACAGAAGGCCATGCTTGTCATGGTCGGTTCAACTTGAACGGCACGCGTGTTACTATCGGACAATGACTGCTGGCTGGCTGACTGGGAACGG
CTCGAAAAGGGCGTGGCGCTTCCGCGTGGACACCTCGCGCCGGGCGAGAACGACTTAATAGACTAATATTACCTGTGTGCTGGGGACGAGATGGCCGGGC
CTCTCGTCGAAGACTGCTCCTTCGAACGGAGCTGGTTGATACGGGACAACACCTGCTGCCGACGCTCAGCAGCAATACTAGCAGTAGCGTCGTCCTCGCC
GACATCATTCAGATGCGGTGGGTCGGTGCGCCACCACTCGACGACGACGACGAGTTCTTGGACCGGTGGCGGCTCTTCCTGTCCGAGTGCTTCATGGCCG
AGTTCAGCGCGTTGAACGACTTCTTCGGCACTCGCCACCCGGATCCGTCCATGTACACGTCGTGGTAGACGTCCGGGTCTCGGAGTCGAGGACGGTCAAC
CGACAAGGTCGGTTTCGCCGCAGCAACGGCTGCAGCTGCAACTGGAGCAACCGAGTGGGTCACCGGCACGCCAGTGCCGTGATGATGCACCGTATGCACC
TCGACGGGCTCGTCCCGATCAAGCTCACGGTGGGCTTCCCGGTCATAGTACCGTTGCAGCGTCTGCCGGACCTCCTCGCGCTTGGGGTCCTCCTGCTGGA
CGACGCGGATGCGCTCCATGGAGGAGGCCTCCTGGCGCCGCATGCGGTCGTACTCCTCGGCCTCCTGTGCCTGCAGCTCCAGCGCAAAGGTGTAGTCCGG
GTCGTCGTCGTCCTCGCGTGCGTCCTCCACCGTCACCTCCTGTTGGATGACGCTCATGACGCCGTGGCCCGAGCTAGAGCTCGGCACCTCCACGAAGCAC
CAGCCGGTCTGGCGGTCGTCGCCACCGAAGCGGCCCTCCATCTCGCGCTCCCACTGCTCCTGCTCCTCGCGCTGCAGCTTGGCCGCCAGCTCCTCGTCCA
TCACGTCGTGCAGCTTGACGGCCACGGGCGACGCGGCGGCCGCCACGGCGCCAGCGCCCCGACCCGGTCGCCCCCACGCGCGTCCTCCAGAGCTCATCGT
TGGGCGAGCGTTATCAGAATAATAATATTGGGATTAAAAGGAGGAGAGGAGCTTGGGCCAAAAGACCTCAGCGTAGTAGGATAAGCAGGCGGAAGGCTCG
AGCCCTGGTGGTTGATGTGTGTGGGTGCGTTGCAGCGCGCAGATGCAGGCCTGCCCCCTTCTACAAGGGCCAATAGGCTCTTGTACAGAGGGATTGCATG
CATTCTGACCAGTGAGTGAAGGTGCAGAAATTGGAGCGCTGTGAGTGGCTGTTTTCATGAGATTGAACACGATGAATTCTGCAAAGTGCGACATCAGTAA
GTACGTGCGAACCACTCGGTGCTCTTTCGCGTACCGCACGCCAGTCGCGTCGCTGACGCAGGCGACAACGAACATGGCTGCACCATCGGCAGCGGCTGGA
TTGTATGCAGTGGCGTGCCGCGAAGCAGCAACGGCGCTCGGCTGTGTAATGGCTCCGTGTTCTTGAGTCGTTCGCGTCGGGGCGTCGCGGAGCCGCTCGC
CAGCAACTGTCGCCACCGCCAGCCGCACGCCATGCACGGCGAAGGTGCTCTCGTCTGCCGGGCGGCGGCAATCGAGGCTGCCTGGCTGAGGCCACACCGG
AGCGTTCTTGCGCCGCTTGCGCACGAGGAGCAGACGTGCATACGCAGGCGCCTCTGGAGCAGGCGCGGCGTAACCAGAAGCAGCCGCCGGCGGCTGCCT