Description :
From Genome Similarity Track
Location :
Scaffold_53:351148- 352829
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16134DEAD/DEAH box RNA helicase
Phypa_INRA-310PPTG_16135hypothetical protein

Sequence
1681 bases(100 bases per row)
TTGCCGACCAAGTTTGGTCAGCTTACCCTTGTTATCCAGCGCACCCAGAGCGTACAGCTTCTCAAGTGCTTTAATCAGAGACGTTTTCAGGGGCTTTTCG
ATAAAATCAAAGCCCAGCACATCATCAATGCCCATGGTTTTCAGCTGCAGCACCACAACCTCGAGGCTCACGCGTTGGATGTCAGGAATCGCACGCTCTG
GAAGCTGCTCGAACGTCTCCTCCGGGAACAAGCGGTAGCAGATACCAGGAGCTTCTCGACCAGCACGACCTGTACGCTGCCAGGCTTGTGCCTTCGACAC
CGACTCGGTCTGCAGCATTTCCATACCGCTCGAGGCAACGAACGAGCGTTGCTTGACAAGTCCCGTGTCCACGACGTACCGGACGCCATTGATAGTGATC
GAAGTCTCTGCAATATTCGTGGCTAGAATCACCTTGCGTACTCCTGCAGGTGCAGGTTCGAACACCTTCATCTGCTGTTCACGCGGCATGGCAGCAAAAA
TCGGACACACCATGAGCTTCAGTGCATCGGCGGGTAGTGATCGAGCGTACTCTTCCAGCAGCGTCTCCAGTGTTTCAATGTCTTCTTGACCCGTCAGGAA
CACCAGGATACTGCCATTGCTCGTCTTCTCCTCCAAGTGAATCTGCAGCACGGCAATCAATGCCGAGTCGAGATAATCCGGCTGAGTCTTGGCCGTGTAG
AATACGTCTACTTGGAACATACGACCTGGAATCTGAATCACCGCCGGCTTGAAATCCTGAAAGAATCTCTTGAATAACGCAACATCCAACGTAGCCGACA
TGACCACCACCTTCAAATCTGAGCGTTTGCGCATAGCGCGCTTCACGATTCCGAACAAAATATCCGTCTGCAGTGTACGTTCGTGAGCCTCATCCAGCAC
CACCACCGAATATCTCTCCAGCGTGGGAGACAGCAGCGCCTCACGCACTAGCATACCGTCCGTCATGAACTTAAGCCTCGTGTTCTTGGACGTCGTGTCG
TCGAAGCGGACGCAGTAACCGACCGCGTCGCCCAGAGGGCCGCGGTTGGCCTCTTCGCACACACGCTGGGCCACTGTGATGGCGGCGACACGACGTGGCT
GCGTGATGGATACGCGCGCATGAGCACGGTCACTCTCCCAAATATATTGCGGGATCTGCGTCGTTTTACCGCTTCCTGTCTCGCCTACGAGGATCACCAC
TTGATTGCCATTGACGGCCTCGATGATTTTGCTGCGGTGCGTGTAGATGGGGAGACGCTGACGAGTGCGTTGCAGCTCCGTGACCGCTGGGCTGGTATTA
ATAGAGCGATGCTGGTATTTTTTATGGTGCTTGAAGCCTGGGCCTGATGACTGCATCGGACGCTTGCGTTGCGCCCCATGGTGCTGCTCATGGTTAGGAA
CCGTCATGGTCGATTGACTGGAGGTTAGTGGCGATACTGAGACCAAGTGAATGCAAGTTTGAATTGGAACAATATGATTGGATAAAATTGGACCAGCTAG
CATGACTTCAACGTCAAGAGTTTCACTAGGACTTGGGCTCGCTCTTATTAGTGACGCGGCATTGATTTTAGTTGTCACTGCGCTTACATCCGGCCTTTGC
GGCCCATCGAGTGCATGCGCTGCTTGGACGGTGCTCTGATCACCACAACACGTCAAATACCTCATCAGCAACTATCATTTT