Description :
From Genome Similarity Track
Location :
contig_43:351132- 352358
Transcript NameFunction/comments
g6387.t1hypothetical protein

Sequence
1226 bases(100 bases per row)
CTCTTCCTCCCTATTGAACGGTGAGGTGGTTCGGAGCATCGGCGAAGTAGGTCTGTAGGATAAACGCGCGTGAGAGCAGCGGCTCAATCTCATTCTCAAC
CCAGTCCTTCGTCGGCAGGCTTTGCAGGAAGAGTACCAAGTCTTGGAACTCGAGCGTCTTGAGCGTCTCGCCAAACGTCATGAGAATGGCAGCGCAAACG
TACACGTGGAAGCCCTCGAAGCCCGAGTCTTCACACAAGTAAGTATCCCAAATGCGTACGATGCCGTCCAGCGGGAGCTCGCGCATGAGCAGGCAGTTCA
TCCAACGGAACGCAAACTGCACGAACTGCACATTCTCACGCTCCACAATGTGCCAAACAGGTCAGCATCGCAACGGTGCACCAGTTCCTCCATGCGCTGC
ACCATGCGCTGCAGGCCCGGTTGAGCAAACGTGTAGTGATCCTGGATATCGTCCAGCAACTTTGTCAAGCACCAGTAGCTGTCTGCCTCCACAATCTGCA
AGTTCTCGTCCGAGATCATCGACAAATCGCACGCCTGCGGCTCATCTGTACATTAAGCATCGCTGTCAGCACCAGCACCTTCATCGCCATGGCCAGTCAT
ATGAAGCTCTCGCTCGCTTACCGATAAAAGCCGAAAGAAATACGACTAAAAACGGGGTCATGAGGTCGTTGATTCCCTGCACGTAGCCACTGGCTGGGTG
CCGGATAGCCCATATATATAGGACGCGTTCCATGCACTGCATGCGCAACGAGGTCATCCACATTAGCATGGTACAAGCAACCCAAGCAATGCCACGGTCG
ACTCACCTGATGGATGCGCTCGCTTTGGAAGAGCTTAACATCAGCGTTGGTGCGTGGAATGTCGACGAAGGATCTGGCGCAGCGTGGTTTGCTCACGCGT
GCCCGATCAGTGTCCGGGATGTAATAATACTGCTGCGCAGTTCTACGTATTCCTGCGCTTTCGCTCCAGCATGGCGGCACGTCGATCTTTCTTCGACGGC
ATGTAGCCCTGCAATCGAGAACAATATCACGGGGTGAGTTCATGGATTCAAGCCAAAAACGCACGCACAAGACACCCGTACCAACAGCAGCCGCCAGACT
GTAGGCCGATGCTTCGTAGGGACCCCACCCCAACTGAGCTTGCGAAGCTGGTCCAGGTCGATGACTTCCTTCTCTAGCAGTCGCTCGAACTGCATGTATC
GAAGGTTCCCTGACGCATTCCGAGAC