Description :
From Genome Similarity Track
Location :
Scaffold_200:35111- 36410
Transcript NameFunction/comments
Phyta_totarag5477hypothetical protein PHYSODRAFT_263945

Sequence
1299 bases(100 bases per row)
CGCACCGGCATCCGCTCCGTGTACCTGCCGCAGCAcatcgtggtgctcgtgcACGGCAACAATGGCTCGGCCGCAGACTTTGATGCTGTGGAGGCGGCGC
TACTGGCTAAATTCGGCGAGCGCCAGCTGCTGATCATCAAGTCTCGGGCCAATGAGCCGGACACGTCGTTGGGCGTGGAGATCGGCGGCACGAGACTCGC
CAAGGAGGTCGTGGAAGCGGTGTTCGAGTATGACTTGAGTCCTGTCGTCAGCAGCTACAAGCTCTCAGTGATCGGCCATTCGCTGGGCGGACTCTATGCG
AGATACGCCCTCGTTCAGATCATGGACGCACTGAGCTGCCTGCACATGGAATACGTCGATTTCGTCACGGTCTGCACGCCGCATTTGGGCTCTAGACGGG
CGAGAGGACCATCGACCATGAAGGTTGGTGGCACTGGCTGTTGCAGTTGATATATTGTGGGGCTGTGCAATCAACTAACTTTGTTGGCGGCGGTTGGTTG
CACAGAATATCCTTCGTCTCGGAGTGCATAAAGTACTGGCGTCGCGATATATATACGGACGGACAGGCAttgatcttctgctggatgGTGAGTTGTCTTA
TCGTGTAGCGAGAAACCTCGTCAATTGATGCTGACTTGTGTGATGTATTGTGAGGGTGCAGCACAAGAACTGCAACAAGAGGGGGTTACAGATGCCGATG
CTGTAGAGCCTGCGCGtccgctgctggaagtgatgAGTGACCCTAATTCGGAGTTTGTCCGCTCGCTCAAGCACTTTCATCACGGCACGCTGGTAGCTAT
GACGGATGGTGACGTGGTAGTGCCGTACCCCTCGGCTTCCATGCGCAGCCACAGCCCGTATGTGAGCACTTTCTTGACGGAGCGCTACATGGATTGGCGA
TGGCATATCCGCCACTCTGGGTTTGTTGAAGGTGACGATAGCAGTCGCACCCACCCTGCATACGCAGCATTCTTGGAGCGACTTAACTCGAAGATTGATA
GCTCGATTGAAATCGAGACGCACGAACTGGGGCTTGATGCAAGGTGCGCTCCAAGGTATCCCAGCATTGAGGGGTTTGACTGTGACAACAAACAGGAGGT
GGAGTTCCCGCACGAGATGCTATGCAGGCTGCAGCGGGTGCTTCCGTGGCGACGCATTGACGTGACAGTGGAGCCCTGCGGCATGAAAGGCAAAATGCGC
CTGCATGACTGGCCGATCAGCAAGATGCAGCCTCCTGACTGCCGTGCGGACGAGTTTATCGATCTGCTGTGTGATATGATCGGAGCCGACCACGAGATG