Description :
From Genome Similarity Track
Location :
Scaffold_942:3510- 7120
Sequence
3610 bases(100 bases per row)
CGACTTTCTGCATCAAGATCCTGTCATGCGGATCCTGAATCCACGACAGATCGACGATTCAAGAGAACCGGTGAGAGCACCAATGAAAACGGCGAACAAG
TTGGTGGTAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGCGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCA
TAGTATCCGCGACGCGGGACCTCCTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATAGATCCGGTGTCGTCGCCGAGGGTCAGCCAAGC
TGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAA
GCGCGGGCGAGGAGCCGAGGACAGGAAGCCCCGGTGAACGTGAAGGCTCGGGATCCAGTACGCCCTACGCGTGATCTGACACAATTCAGCCAGGATCGAG
CCAGATCCAGCAAGAAGCCAGTAAGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGCCAGTGGGCCAGACGGCCACAGGCTA
TTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGACGAGTCGTTTCCTGGCCGAATAGGGTATGAGAGCGCCCGTGCCACAAGTGCAA
GTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAG
CAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGA
TCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGAT
CTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAATACTGTG
GATTAGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTGGAATACCTACATCGACTAAATGTGGCCGGTCTACG
GGCTAAGTTGAAAATTAAAGATGGGGGATCCAAGGTACTGCGGGAGCACGTGGATCATTTCATCGAGACATTGGGAGACGTGGATCTGGCCGACAGGCTG
ACCCTGTTACGACTTCCTGATGCAGATGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCA
AGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGA
CTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACAACTCTCGACCGGGGGATACCGTACCCGGG
GACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCCCAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGA
AACATCTGGTCTGTGAGAAGTGTGGCAAGAATGGTCATCCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTG
TCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAAAAGTGGCCGAGAAGATGTTAAACTAGGAC
GCTCGCCGGGGTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGA
TCCAGTCGATAATACACGTGATTTACATGAAGTGTCAGTTGGCAAGGTCTCTAGTTTGCGCCAAGTGGATGAGTTTTCCAGATCCGAAGTTTCTTCAACC
CTGGATCTACACAGAGGAGAGGCACGTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAAGTCACTGCAGATCCACCTA
AGGTCTGTCTGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCGCCAGG
AAAGTGGTTCAGACAAGCCAAGGTAGGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCTC
CTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTAGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATC
AAGATCACGCTGGCCGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGAGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCACGGTGCCGG
CCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGACGACCGTTGTATGGGGCGAAGATGAG
GATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCGGTTAAAGTGGGTGAAACATGAAAGACTGTGGGTCACT
CGGGGCGAGAAATGGGTACCTACCGTAATCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGATTATTACTGGACCATT
ATGAGGAGATCGGACGATGGTTGTCTAATGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGAATCCCGCCGCTATAAAGAATGGCAGAATCTGGT
GTACGAGACGACTACCGAGATCGAATCTCTCGCAGAGGTGGAGCTCTCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGA
AAGATCCTGCAGAGGGATCGACGGTTTGAGATCCAAGCAATGGAAGTTGGGATCCAGGACGGGGGACGATCCCCAGAGTCGGGCCCTTAGATAACGCAAG
GTCGTGGATGAGGATGCAGAGGGCTAAAGCCGAGGCAGCCCGGATTCCGGCTGATCCACAAGTGGATCCAAAGCCTCTCCATTGGATAAAGTGCCTGAAT
CCCTATCGAGAGTGGCAACACTAGTCAAACCCGAACTGTCGGGCTCAAACTCGTTAGAGGACCAACTGGATCCAACTGGGTGGTTTCCCTGATACCAGGG
TACCTGAACCCCCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAAACGGAAGATGAGCAAGTCTG
TAACCGTGAAGGCGGGGATCTACACGCCGAGGATCTAGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAAGTCACGATTGATGAT
ATCCAAGTGG