Description :
From Genome Similarity Track
Location :
Scaffold_955:351- 2467
Transcript NameFunction/comments
g16821.t1hypothetical protein

Sequence
2116 bases(100 bases per row)
CGGGGTGTGAATGCTGCTGCGAATCGCTGTTTCCCAGAATTTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGC
CCAATTACCCAGTCTCCCCTGGAAGCTGGTTGAGTTGACCAGCCAAGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGATCTCGTCGTCAACAGGGTG
TAATTCACGTCCAGCATCCACAGGAGTGCCAAGACTTCCTTGTCGACAATCCCGTAGTTGATCTCGTTGGGCTTCAGAGTACGACTGGTGAAGGTTACTG
GCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTT
CAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATCTTCGCTCGGGCCCAACGGTCAGCATCTTCTGCTCGCGTGACACGCCCCCAG
CTACTTGTTCGCCAGGGATGGACCTGTTCTGCTGAACTATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGGACAGCGGCATAGACCGCGAAGTCTTC
GATGAAACGACTGTAGTAGTTCAAGCTTCCGAGGAAGGACTGCATCGATCGCAGTGTCTGCGGGAAGGGAAGGTTGCCTAACATCTCAAGATCTTTCGGA
TGGGCTTCCAAACACTCGGTGTCCCAAGTAGTCCACTTTTCGTCGGCCCCAGAAACTTTTGACCACACTGACGGACAAATTCCATCGTTCGCAAGCATCG
AGCAGTGCTTCAACCTTCTCACACAGCATGTCCCAAGTGATCGCAATCACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGACGGTCTCGGCT
CTGGTTCTGGCTCGCCTGAATCGAACACGTCGATCGGTTCCGACGGACCGTGACCGGCGCAGATTCGGAAATGTCCGTACAGCGCGTTATCAATCAATCG
CTGGTAGATCTGTGGCGCATTCTTCAATCCAAAAGGCATACGCGTCCACTCGAACAAACCGAACGGTGTGATGAAAGCAGAGATCCTCCGTGCGCGTTCT
GTTATGGAGACTACCCAGAAGCCACTCGCCATATCGAGTGAGCAATACCAGAGCATTTTGTCCAAGTCTTCCAAGAGATCGCTAATCAGCGGCATGGGAT
ACACCATCAGTCCCGTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAGGCCCA
CGGTGAAGTCGACGGCGTGATCATCTTCGCCGATAACAGGCTCTTGATCAGATCCGACAGCTTCTCGCGGAACTGTGGAGCGACTTTTCGGACACGTTGT
GCAACAGGAGCTGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCGGCTGGTGGTAACGCGTTTCCTTTCCCGATCAGGAGATGTTTCCGCCTCC
AAATTATCTGTCGCAGACGATCGATTTCTTCCGGGGTGTTTGACTCAGGATCGCCCACCTGGATATCCTCGATCGTGACTTCATCGGTGGTGGTCACTAC
TTCCGGTAAGATTGCCATCTGTCTTTCCACATCTTCCGCGAACAGGTCGCCACCTTCGTGGTTACATACTTCTTCGTCATCCAGCGGTTCCGGAGCAACG
ATCGGAGGCGTTTCGACCCGGCAAAGACTCTTTCCGGTCCGCAGTCATCTCGCTTCGTGTGGCCTGCTCCGTTGGCGGAGATTCTCTCGCGTCCTGATCG
CCGGTGCCACCTTCCTGGTCCCTTGGAGACCCCTCAGTTTCTGGTTTCATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCGATCTCGAGGTTC
CGCGGTCACGACGCAGGATTTTCATCGGTGTGTCGTACTGAGGTCGATCTACCATGGGTCCGGTAGGAGCGAGTTCACGTTCTTCTACCTCCACGCAGTC
TGTAGTGGACTGGAAAACCAGATTCTGCCACTCGGCATACCTGCGCGATCCGAGTAACACGAAACCGGGAGTGCGAGGTACGCGTCCTCCTTCGAGCCAC
ATGCCGACGTGGGTGT