Description :
From Genome Similarity Track
Location :
Scaffold_676:351- 1467
Transcript NameFunction/comments
Phypl_g10252hypothetical protein

Sequence
1116 bases(100 bases per row)
AATGTTCCACAACGACGGATGGTAACGAGTGATTCACGTCCTGTGAAAATATCGCCAAAATTCCTCCCATTTTGTGGTCGAGTAAGATATCGATCGCGCT
GCACACTTCGATATGATTTTATCTTTCACCCACTTGATTCCTTGTTTCTCCACCTTGTTTTGCGGTACAACTGTCAACATATCTAAGACTCCACTTCTCA
TCGCGATCTTACATTCGCTATCAGGAATTCGATACTTCCTCATTTTTCTCCTGCACGCTTGCTTAAAATGAAACAAACAACCGATTGGAGCGGCTTCAGG
AAAGTGGTCACGTATTGCACGAATTATTCCAGCTTCAAAATCACAGTAGACAAATTCAGGCTCAATTTCATCTCCTGTAGCATCTCGAACTAGACGCATT
GCGTTGAAGTACATATTGTACTGCTTAGAAGTGCAAAGTACGAACGCGGCTGGATAGTAGCCTTTGGTGGCATGATCATAAGTTGTAACCACTATGCATT
GCTTAAACTTTGGGGGCACGCACCGAAACGTGCTATCCACAAACACAGACGTCCGTTTCTGTTTTAGCATGTTCAAGAGTACTGGATGACCCCACCCGAG
AATCCGTTACCTCTTCTTCGTAACTCGGTCGAAATACGAGTAATGAAATAGCAGGAAATTGGTGTCCGTTGCTGAACCGCTGTCATTTAAGACCTGAGAC
CACGGCGATACTTCAATTTGACCATATACAGATCCACCAAATTCTTCAGCTCTGACGCGGTTTACTCGCCTTATGACGTACTCCCGACTCAATCCAACCC
GACCGACACCACGATCTGAAGATCCGTAAAACTTGGCTCTCACCATTTCCCAGATAGCAGAACGACTCGCCGTCATCGTGACGACAAGCCGGTCGACTTC
TTGCTTCATTGCTGCCGTAACGTTAACGGTAGTCGATGGCTGCATTGCTGCAATATCTGATTCCACGGCTGAACGACCACAAGTGTGTGGAACAAAATTT
GTGTATCTCTGTGCACTAAAAACAAAGTCACCTTTTCCTCTGCAGTGTTGACGATAGTGACTGCATCGGTAGGATATTTTGCTGGAATATCTGTTTGCAC
ATGTGTATTTGTATCC