Description :
From Genome Similarity Track
Location :
Scaffold_1633:351- 1423
Sequence
1072 bases(100 bases per row)
GGATGACGAGCGCTGGATCGAAAGCGTACAGCTCTTTGAACGCACTGTCCATCTCTTGAACACTAGGGGGTCTGCTATGTCTGCCGATTCCAACGTTTGC
AGGATATTGTCAGCTCTTCCATCGAAATAGACCAGTGCTCCTTACACCACAGTTCATCGCGGCGTTTGATAATTTCCATCGCTTCCGTACTTGGTTGGAA
GCTGCAGTCTTCGTAGAACGCCTTACCCGTCTGCTTATAACTTTTCTCCATATTATTACCAGGGATTTTCTAGCTAATAGCACGGTCCTTTGTTAGCTAG
ACCCAGTGACCTATTTACTCGAATCTGAAATGAACTAAAAGTTGGGGAGTGTACATACAATATATCTTCCTGATTCATAGTTTTTAACAAGAGCTGCCTC
GGAAAAGTATGCAGTGCCTCTATAGCGCGAAAGTCAAATTATAATATGATTATGGATAAACAACTCGTAGGATGAATTACATGTAAAACAAAAGAAAGTA
CCAAACTGAACGACATGGTAATCAAATATGCCTGTTCATACAAAAGCCAAAGATTAGTTATCTGTTCATACATCTGACAAACTCAGATTGGTTACCCATC
TTTCGGTGCATAACTGTGGTGATGCACTTTCCGAAATGACCTGCGAACGATGGACGGGAAATGGAATGGGTCACTAACCCGGATTAGTGCCATATTGGAT
GAGAGGCGTGAATATTACCGGCAACTTAGTCTAAAGTCACGACTGGGACAAGGACAGAATTGAGGGAAGGGGTTATGCAGTTCAAGCGAATGGAAGACAA
GATCGGGGTAGATCGGATCTTACTTTCGGAGATCTGGATCCTAAATCTCAGATCTCCGTGAATCTGATCTACACCGTAGAATTAGATCCTAGATCCAAGA
TCGGTGCGGACCTGATCTGCACGGTCGATCTAGATCCGAGATCAGAATAGATCTCAGAAATGGGAAGAAGGTACCGACCTAGAGCCAGTTGTGTAGAGGT
TGTGAGGATAGGAGTTTGGGATGGGATATGCTTAACCATGAATCANTAATATATTGACCAGATCTTCCTACT