Description :
From Genome Similarity Track
Location :
Scaffold_439:3509- 6201
Sequence
2692 bases(100 bases per row)
CCTCCCCCCCTTGAACGAGAGTCACACTCTAAAAAGGTCGGAAGACGAGGTTGGCGTAAGCCATTTACGAAGAAGGCCGTGTGCTTCGTCGACGCATGGA
CTGAATTGTTGATGGCGAACTCCACCATCGGCAATAATTCGCTCCAATTTGTAAAATAATAGACGTACTCTCGGAGAATCTCCTCGAGGACACGATTGGA
GCCTTCTGTTTAACCATCTATTTTAGGATGGGTAGACGTGGACATCTTTAAGCGCGTTCCAAGTGTTTGAACACGGAACGCCAGAACTCGGCTGTGAACC
GCGGGCCCTGATCGGACACAAGTTCACAAGTCAACCCATGGAGGCGAAAGACCGTGTCGATATAGACCTGGGCACAAGCCGATGCGTTAATTGATTCGGG
AACAGCAACCAGATGTATTATCTTGCTGAATCTGTCAACGAACACAAGAATATCAGTATTTTTGTGAGAGTATGCGGGAAATCCGAAGACAAAGTCCATT
GAGACAGATTCCTAGCACTCTGCCGGGACGGGAAGAGGCTGTAATAAAGCTGCACGGAAGGACTAGACTTCACCAGTTGACGTACCTCGGAGGTACGAAC
GTACTCGCGCACGAACTGATACTGGCGGGGCCAGTAAAAGTCGTGGCTCACTGCGAGATATATTTTTTCACGACCACTATGTCCACCAACAGGTGCGTGA
TGGTACTCTTACATGATACGCAATCGCAGATGATGATCTGGTACGACGACAAGAGGCATGTCGCCAGCATAAGCCAAATCTTGGAGTAAGACGTTGCGAA
CTGTATATCTATCCGTAGAGGATCGATATACTGACGACAACAGTTTGAGGCTTTTCCCGGATGTTTACTAGAGATGATGCAGCAATCGAACCATCCCTGG
ATGATACGCCTTTCGTATGTCGGCCAATAAAGTTGACGACGGGACACACTAAGTCAGTACCGCGACAGTAGTCGGATCATTGTCGGGTGACGGCATGTTT
GCGACTTCTGATCGCTGGTTGAGTCCCACCCGGTTCTTGATGACACATCTCCGGAATCGGGCCGGCGCGAGAGTGCGATAGCGACGACGTTAAGTCGTCC
TGGCTTACACTCGACGGGGAAGTTGTACTCCGCAAAGAATGACAGCCACCTCGCCATCCGCTGCGAGAGATGTGAAATGTTTACGGTCCTTCGTAAAGAT
GCATGGTCCGTATAGACGATAAAGGATCTATAGCCTAGCAGATAAACGATGAATTTATCCAGCGTGTACTTCATGGAAAGGAGTTCCTTGTCATCGACGG
GGTAGTTGCGTTTTGCTGGTTTCAGCTGGTTTGATTGATAACAGACGACACGTTCCGCATCGTCTGCATCGTACTGCACCAACGCAAAGCCGATTGCAAA
GTCACTGGCGTCACAGACTATGTGGACTGGCCTGTCTTGGTCTGCAATCGCTGTAACTGGCGATTGTATTAAGCTTTGCTCGATACCTTCGAAAGAGCGC
TGACAATCGGCACTTAATATCCACTTCTCGTTCTTTTTACTAAACGAGAGAGATGGACAGTCATCTCGGCGTAATTGCGTGAATATTTGTGCAAACACGA
CGCTAGACCAAGGAACTTCCGAAGCCTCATGACATCTGTAATCACCGGCCAGTTTGTGATTGCCTTGATCTTTTTCGGATCGGGCCGGACGCCATGCTTA
CCCACGATGCAACCAAGAAGTGGTGTTTTGTTAGCATCAAATATACACTTCTTGAGGTTGGCATAAATTATGCACGCGCATAATTGTAAGAATCTTCCGA
ACGAGGAGTCGGTGCACTTCCACATCCGTCTATTCCTTTATAGCCCGGCTATGGACAAACACTTCACGAAATAGATGGGCACAAACTACCTTATGGATCT
TAACAGATTCTTCACACATCTTTAAATGTGATAAAGCATTACTTAGCCCTTAAGGCATGACTGACCACTCCCAAAGTATACCGCTTGGGGTGCTCACTTC
AGTATAGGGAATGCCCCTCTTGCGCATAAGGGTTTAATAGAACCCATCCATCAGATCCATGGATGAAAATATGGTACTTTTGCCATACCATCTATGATGA
CATCTTTCCTAGGTATTGGTGTTTGAGCCGGTACAGTAGCAGCATTCAACTTGTTAAAGGCATTTACTATCTGCCACCCTCATGTGGCTTTTCGCAAACA
GAAGGTCGGAGAGATATGTGTCGATGTTGACTCCCTCACATTGCCGGCTGCTAAGCGATCTGCAAAGAATTTGTCGATCGCTAGTACTTGTTCACGAGGC
AGCGGCTATTGCTTCATGACACAGTACTTCGAACCCGGTTTCAGGTCGATTTCGTGACGAGTACCTTTGTCCTTAGTTAATTCGCATGGGATTGCTTCTG
GGAATACATTCCTGAATTTCATCAAATCATCGAAGAGAAGATTTGCTTTGAACGATTCCAACGATTGACTTATCCCATGTCTTCTCATCAAGGACACTCT
CGTCCATTGATGAGCTACAGAGAACCCTTTCACCCTCGGTAAAGACCATTGCCGATCGGATATCACCTAAAAGTACTCATCTTCCGCGACGAGTACGCAG
ATGTGCTTGACTTTGCCACTACGCATATCACGCAAGATTCTCTTTTGGTTCACCAGAGGGAACTGATTGATCTCCAAAGTTAACTTCAGAGG