Description :
From Genome Similarity Track
Location :
Scaffold_423:3509- 4921
Sequence
1412 bases(100 bases per row)
GAAATAAAGACACACACCAATAAGTGTGATTTAAAAAGTTCAGCATCTCGCATTCACGCCCAATTCCCTTAAATTTACACCCTTTGCCAAATTTAGTTTT
TCACCCTTTTACAAGACCTATAATTCGCACTCATTTGATAAAGCAACTGCTAGATTTACCACACGTATTCGCCATTTCCATCACAGTACCCACAATTACA
CCCTTTATAGTTGCAATATATGCTGCAGTAATATTCGACATCACGTGCAATAGCCTACAGGCGTAGCTCAAAAACGTGTCGTTATCTCTAAAATCCAGGT
ACACACCAGCCTTCTAGCGTAAAGCCTTGCTCTTGAGATGTGTGAAATACATTTTCCTACGGCTAAACAAACCACAAAGAACACAAACAGGAACGATGAT
GCGGACATTTCATCGACTGCCATCATTTAGGGAACTACGTTTTTGAAAGAAAAAGCATGGACTGCATACATTAATCTTGTATACGGCTGTTTTAAGGAAA
ATTAAGTGCGAAAGGTCAAGATTTGAGTTTCAATAGGCGTATTTCTACACGATGGACTGTTCGACAAGCACAGCTATTAATGGATTTACACTGTCTTGTA
CAGTAAATCCCTTCTTAAGTTTGTGGGACCTGAGTCTTGCGGCAGATGTGGCTACGATATAAATCACCTGTTTCGTCTTTATCTTACTAGGATACCTTTC
ATGTTGACATAAGGACGCTCCTGAAAGTTAGCATGAGATGTGCTGTACCAATACATCTGTAAATATCCATTCGATACAACGAAAGCAATCGATATGCTAT
AGACGTAGAACAGAGTGCAAACCTTGTAATTGACAACGTACAGGTTGTCATCATTGTGGTCGAGTATTTGTTATTGCTCGCCAATTTTTGAATGTTATTT
TGATCTTATAGTGCACCGCTTCGTCCTCTAGTCGCAGTTGCACCTGTACGCTGATCGTCAGCGACTGCTATTCCCAGGCATTCAACGGCACTGATCCTTC
TTCAATGTCTAAAATTACCAATGATGGGTTTGAAATATTGCAATTTCTTTTTATTGGGTGGACTGAAGTAGATTGGTCGGAATTCGAAAAGTCATTGTGT
TATTTTTCAGCATCAAATTATGAGGGGTGTAATTGTGGTAATGTAGTGGAAATAGCAGATACGCAGATTAAATTGATTAGATCACTCTTGCCAAACCAAC
CATTACCCTACTTTTTCCTATCACCTTCTCCGTACATAAAAAGGGAGGTATCTGATGATGTTGTGTGCCTTCATTTCACATTCTTTTTCTCTGGGGTCTG
AATGTCGCTTGACNNNNNNNNNNGCATGAGATGTGCTGTACCAATACATCTGTAAATATCCATTCGATACAACGAAAGCAATCGATATGCTATAGACGTA
GAACAGAGTGCA