Description :
From Genome Similarity Track
Location :
scaffold_23:350889- 353139
Sequence
2250 bases(100 bases per row)
AAGGCAGTGGGATTGCTGAAATGGTGCGGTTGGAATCGACGAAGGAGCttagttcatcatccgtcgtgAATGAATCTGCCATTTAGGCGGCCACTGGGTG
CGAAACGTTTGaccgctaccttcaaggaTTATACAAATCCTGTCTATCCTGACAAAATATCACAACATGATGGCGAGAGATCCACCACGCATGTTGTTCA
CGGATAGGGGTGTGttgttaaaaaaaatatggctCCCGGAAGGAGATATTGCACCACACAGTAATGGCCTTTCCCAAGGGAGCAATTTGACGCTAATGAC
ACTTCTTCTCGTGGTTTCGGCGCGAGAAAGTAAATCTACATACTTGTCGATCTTTTGTGTCCGAAAGGCCAACGGCATGTGGTGAATTGTGCATGCTTCT
AACAAAGCAGATGCAGCCGCGATTTCGGAGTAAACGCCTATTTCTAGAAGGTAGGTGCTGCAGAACAGCATAGCGGACCGCACTTTATCCAGTGCCGCAT
ACTTGACTTATGTTTATTATCACCTGCTAAGAAAAGGTAATATCTCTCTCACTGCGGTGTATACTCCAGATGAGGACTGTAGTAACGGCTGCTTATGCTA
GAGTGATTGTCTAATGCCCCAGCGATGCTCATTTGCCTAGTGGCACAGCTGTTCGGGCCACATCGTCGCTATGCATGGGTCGATTTCAAAGATATGTTCG
TCATTTTTTTTGTAAACACGGGACGTTGCCGGTTGTGTAAAGCCACATTGATGCACTTGCGAGCGGATagtcgagtgtatgcgccaATTGAAGCAATTCG
CCAATATCGACAGATGCGCCGACGGCCCCCAACCAAGTCTGCTTTCTCGCTACTTCATTGTAAATCAGGGTCTGCAGAAAGATCGCGCAAAGATTTAGGC
AACGGAACACTGTCCAGTGCCTCTGACCGACTGGGGAGAGTGGATTTGGCCTGGCCAACTTCTACTGAGCAATTACAGTGCAAACTACACCACCCCTTAT
CAATCGTCTTGAAAATATTAGATGGTGCCGGCGTGCGGTGGATGAGGCAGATTTTAAGgcttcaaaagaaaatatcATGCATACCCGATTCAATTTTTAC
AAATCCAGATCAGCCATTCCACGCCGTCTTTGACGATTTAGCCTCTGCAATAGGCTGCGCTTTACTTCGAGCACATGAGCGCATGATCAAGTCTGGGCat
cgccagcttaaagctgcttaGTAGAACCACCCAGCCCATGACAAGGATTGCAGTATACCCTCATCAAGCTTAGGGTGTATCTGCTTAACTCTGACCCTTT
TATGATCTGTACATATGCACTGTTGCGTACGGCAACGCTGTCACCTCACTCCACAGAGAATGGCAAGATATCTAACCTTTTTTGGTATAACTTTGAAGTA
AGGTATGAGCCTAGTCGGCTTAAATATCACCCATTGATGAGGAGAATGTGAATTAGATGCAACATATGCTGCTTTTCTAAAAACCTTTACAAAGCAAAGT
GTTTGAGACTCAGATGTTGCTTTATCAAAACATGCGGTTGCACTATGCTTGGTTCCGAGAATTATTGTATTACAGCACGAATTTAGATGACAATCAGCTT
ATAGTGGTGCCTCACGATGATGGCCTTCAGCACAAGTTACCGTACGAGACACACGATATACCTTTGTGTGGCCATTGCAAAAGATAAAAGGCATACGGCT
AGGTAAGCGCTGCCATGCAGGCGTAAGCCGGTAGGAACAtatatgcgcacgtgtgaaacgtgCCAGCGGGTCACACTCTCGCCAAATTCGGCGGTATTTT
TTACCAGCCTGCCAGTACCAGCAGAGCGCTGGTAGTCCTTTAATATAGACTTTATTTTTGGTCTTGTGAAAGACATACCTGGTGATACCTGTACTGTGGT
CATTGCGAAACGTCGGAGTAAGATGGCTCGTGCTGATGTGACCAGTGGCGATACAGCAAAGATGTTCCTCAACAAAGGGCTTCACTAGCAGTTTAGTAGT
TAGTCATTGGATTGGATTCAAATCCGCActttacagcaaaattttgaaaaaaattcgaAAGAATCGGCATCAGATTGGATAAGTCTTCCGCTGACCACCA
CACAAGCATATGGTCAGCGACAGTGCGTGAATGGATTTGTAGATTACATCCTCCGAATCTCTTGCGTAGAAAGATAGCGGTACTTGAGCGAGTTGTTATA
GTGTTTGCGTTTattattgcaatatattCTTCTACAGGCGTTACCCTATT