Description :
From Genome Similarity Track
Location :
contig_60:350855- 351966
Transcript NameFunction/comments
g10744.t1hypothetical protein

Sequence
1111 bases(100 bases per row)
ACGCGCCGCACGTAGTCCACAAGCTCAGCCGAGTAATATTCGGCCACCGAGATCACATCCTCCGATCCACACTGATGGATGCGCGTAAGCGGCACATCCA
AAATTGACGCAAATTTGAGGAACATGGCACGCAGCAGGATAACAGAGGACGGGTCATTTTTCACGCGCTGGTGTAGGATCTTCATGAAGTCATTGATAAC
CTCCCAGGCATACGACAGGTCTGACACGTTCTCAATAATGCCCATAACCTCGTCTCGAATGCGGACAGTGCGCACCATCTCGGTGAGAAATTCCCGCGAC
TCCTCCAGATATGCCTTCACCTGTAGGTTTGTGTCAATCTGGTCAAACTGCTCAACGTGGCCCAACGCCTCGATCAGGCGCTTAATTCGCCGTCCAGCTT
TAATGTGATCCACGTAATCCAGGCTGTTCACCTTTTCAGCCAAGTCCTTGAACCACTTCAAGAGATCTTCATTGCGCTCCACACGAGTCAGTGGCTTCTC
TCCGGAGAAGTATTCGCTGAGTTCCTCCATGCGCTCTGATGTCTCTTTCATGCAGCGCTGCCACCGGTCTTCTTTACTAGCTAGCAGTGCCTCGAACATT
TGCTTTAGCTTCCACTCTAGCTGCGAGACCTTCAACAGCAGTGTGATCAACTTGTCCGGATCTGTGCCCTTGTCGAAGATCTCGCGCTGAGCTGTTGAGT
TTTCCATCAAAGGAATCGTTGGTTGAATTCGAGAGTGCATCATCGTCCAACGGATTGTCACGTTGGCATTACGGATGCAGTTCAGTAGCGGGTCCAGGTT
TTCCAGCACGTACATTTCTGTAAGCACGCCTTCCGTAAGGAAGTAGTTGAGCTCATCGATGGACCGCTGTGTTTGCTGTGCCTTCTTCTTGGTAATGTGC
GCGATATTCGACGGTTCCAGCGTGTTTGCGAGTGCTAAACGCGCCGCTGGATACGCCGCCCACTCCAGCGATAGGTCGGCTACTGCGCCCATGTACGTTG
TCAGGATAAAGTTATCGTTGAAGTGGCGATCCACGATTTCGCGCATACTTGCCTTCTCGTGGATAAGAATATCCGGGGCGAAGAACAGAATCACAAACAG
CATTGATGCCT