Description :
From Genome Similarity Track
Location :
scaffold_278:35081- 43074
Transcript NameFunction/comments
g6724.t1 hypothetical protein PHYSODRAFT_339130
g6725.t1hypothetical protein

Sequence
7993 bases(100 bases per row)
ATCTCGACCCCCCAAGATCCCCGCTATAGGAGGCGGCAAGCAACAAGTTAAAGGAAAAGGAATACACCCCAACAAGTCACCCCCGGATCCAAGGATCCAC
CAGATCTTCGGCCCAAGACCAAGATCTACCTACCCAGAGCCTGCGTGCAGGAATACCCACGCAGGATCCAACCTCCGAGTCCCCGCCAAGGACGTTCAAG
CTTCACACCACTGCACATCACTCCTGCCCCCAAGCGAGCAGACCCCGCCCACTGACGGGTACACAAGGTGAGCCTCTCAGCAACTCCACGGTTATCGGAG
TACCCCCTCCGTTAGTCAGTGTCTGGACGCCGTGTGTGAGTGTGGGATCCCTGCTCATTCCAGCGGAACCACTCCACCACAATGGTGCGCGTGCCCGGAT
CTTTTGGGGACGACGGATATCACCGTGAGTCCCAAGAGGATGTGCAAGTGAAGAAAGAACCGGGAGAAGAAGTACCAACGGTATTTGGATCGCCGTCGGT
ACCGCTGAACGCGAGATCCACAGATCGACAGAGTCCTGGGAGGAGCTCTGCCGACCGAAAGGAGGAGAGTCTGGCGACGGACTTGGAAGAAAAACCTCCC
CCTCCTCCCCAGGTCCCTTCGGGGACCCCCGAGGATCGAAGCGCGAGCTTTGATCCGCCGGGTGGGGATCAGATGGCGAAAGCTGTTGGATCTTCATCCA
CCACCACCACCGCGCCGGTCACAGGTGCCAAGACGTCGAAGAAGAAGACGAAGACCGCGCGGAAGAAGCCGAAGACACCAGACTCTGACGCAGAAGAGAA
GCCTACCCCGAAGGCCGAGTGGACGTCGTCCAAGTTGGAGACTGCGTACCAGCGCGTCTCACTCAAGAACTTCCTACGGGAGGATCCTGTGATGAGGATC
CTGCAACCACAGTTGCTACGATCTCTCACAGGCCCCGTGTTGGCGCCCGCGTCGTCCACGACCAGTCTGGACTGTGCCTTGGACCTCCTGCGCCTGCTGG
ATGAAGCTGGATTCACGGCTGGAGCGTTCGACGGCGAGGCCCTCTTCCGCCTAGATCATGATCTGATCCGGACGGCGGCAGCCTCGCTATTCACGCGGCT
GAAACCTCTGGTTGGAGAACGACGCCTGTCCAAACGTCCAGCAACAAAGAACGTGCAGATGAACTCGCCCGAGTACCAGACGGGATCGTCTCGGTACGCC
TCGGCCGAGTCTGAGGCTGAGTCGGACAGCTCGTCCGAACCTCGGCGCATATCGCTCGTCCCGGCAGGAGCTGCCATGCTGCAAGCCCGTTTGCCGATTG
GGGTCCCCGACACTGCACCCGTGCCTGCCACAGCTACCCCGAAGCCACTGCCGAAGCAAATGCTCGCCAAGGACCCGTCGCACGAGTCGACCGACAGGCT
GGAAGCGTACTTCCAGTCGGCGATGAGTCGGTTCTTGAAGGAGCATCAGGTGAATGACAGTGGCTGCGGTGAACGCCGGAGCTCAGGACGTCGACATGGA
GTCGGTAGGATCGCACCCCAAACGCTGGGAGTACGATCCAGACGACCTCGACGGAGCAGGTGCCCGGCGGACGGCAGCAACGGCAACGCCAACAGCTGCG
CCCATAACAGAAGGCAGTATGATCCTGCGCGTCCGGTTCTCAGCGATCTCGGACCTGAAGGAGTTCACGGGCAAAGACCATGACGAAGAACGAGCAAGAG
CTTGGTTAAGCAAGATCAAGTCTGCATTCACTAGGGATCAAGCTTCGGACGAGGAGAAGTGCCTAACGTTCGCGGATCTGCTCACGGGCCCGTCGAGGAA
CTGGTACCGTCAACTTGGCCGGTCGACGAGGCTGAAGTGGAGCGATCTGCTCCGATGCTTCCAGACGCAGTACTGCGGCCTTGGAGTGTCCGTGGCCGGG
CAGTACTACCATACGCGCAAGCGCTCGGAGGAGTCGCCGCTTGAGTACTTGTACCGCCTCAACGTCGCAGGCATGCGCGCCCATGTGAAGGTCAAGGACG
GGGACGCTAAGTCCTGCCGAGAGCACGTGGAGCATTTCATCGAGACGCTTGGTGATCAGGAGCTAGCTGAACAGTTGACGCTGCTGCGGCTTGCCGATGC
GGAGCAGTTGGAAGACGTACTGCGTGCGCGGGACCGTGCAAAGTCCCGCCAGAAGAAGCCATCGTCTGGATCCAGCAAAGCCCGATGCAAGCCACCAGCA
ACGCCGCAACCAACAAGCCCCACGCGCGCGATCCGAGCCATGCAGATGGCTGAGTCGGAGTATGGATCCGACTCGGACGAGTCAGGATCCGAAGGCGAGC
TGCGCCGAGCGTATGTCGCGGCGTCAAACGAACCGCGGCAAGCTGCCACGGCCAAGGGAGCGACTGGATCCTCGGATCCTAAGGCGCCGGCTCAAACCAG
TGCGGACCCACCGCCACAGGATCGCCAGCCTCGCTATTCCAACGACGGACAGCGTTGTACGCATTGCGGATCCCGGAAACACTCGGATCTCGGCTACTGG
AAGCGCTTGACCTGCCAGAAGTGTGGCAAGAGAGGCCACCCGTCGGATCGTTGCTTCTTCGTCTGCCGAGGCTGCGGCGAGCTCCATGATCACGGCAAGT
ACCAGATGGAGGAGTTCTACTACCTCATCCGCCAGTGGTTTGATCCTGCCAAGCACATGCTTCCGGAGGCTGCTGGGAAGATGTTAAACTAGGACGCTCA
CCTGGTTTGAATCCGGTACGAGACGAGCGTTCTGCGTCTTACATCTATGCATATGTGAACAAGAAGTCAATGGATCACGTTAGCGTCAAGTCAGCGGATC
TATTTGATAATACACGTGAACTACATGGGAAACGTACGGCAAAGGTTGCAAGCTTTCGCTCTGCTGACGACTATCAACGATCCGAGGTCGCCATGACCTT
GGATCTAATGCCCGGGGAGTCACGCGGGTACTGGAAGTACCATGTCCCCAGCAAGCACTTCAAGCAGGCCAAGGCAACGTGCACGATCAACAATGCCAAG
TCCACCGTGCTTCTTGACTCGGGATCTGAGGTGTCGACCATCGACGCCGCATTTGCTCGTAAGGTAGGATCCCACATCGACACTAGTCAAACACAAGAAT
GCCTCGGAATTGGTGAGCAATTGTACGTTGCAGCAGGCAGAACAAGGATCAAAGTTACCTTGGCCGGGTACTTGGTGTACTTCTGCGATGTGTGGGTCGG
CGAGGATCTTCCACCCAACTGCGACGGGATCCTTGGCATGGACTTCATGGTCCTGGCTGGGATCCGACTTTACTTGGGCGACGGATCCGTGTGCTTGCAT
GACGAGATCCTGATCCGGCTTCACGGGCGGCGCCAGATCTTCATCGGCCGAGACCGACCCTTGCTGCTTCAGGAAGGCGTGCGGCTCGAGCCCGGCGACA
CGTTCGAGCATCCAGATCGGATCCGGCTCAAAGAGTACGAGAAGCTGTGGCTGCGGAGAGGCAAGCAATGGGTACCGACGTTAGTGCAAGACCCAGGCAA
GATCCGCTATCTGCAACTTACCAACATCGGCGAGTCCGCCATCACCTTGAACCGCAACGAGGAGATCGGCATGTGGCTGGCCGGCGACCACGTCCCTCGC
ACCCCAGGCTTCATCTCCGTCGGGTCGCGGCGCTACAACGAGTGGCATAACCTTGCCGCGAGCGCCACGACCGAGTTTCGGCCGCGGAGGCGGCCGAAGG
AGCCCTGGGATCTGGAGTCGGCGGAGGATCGCCCGGCGTATCCGGAACCCAAGGCGCTACTGAAGAGACCTGATCCGACGGCGGTGGTGCGTGTCAACGC
TGTGCACCACCGCCCAGGCTCTGTGCACAGTGACAGTGTTGAAGCTAGACGGTCGCCACCGGCGACCGACAGTGACCATCACTCAGGCGCGACAAGCCCG
AAGGACACGTCAGCGTGCCAACCCCCCGCGGAGCCAGGTCTACGAGCCGGAGCTAAAGATACCTGCAGAGCTACAAGTGGCGAGCATGAAGAGCCGCCGC
ACGCCGCGATCCGATACCTGGAAGCCAAGGAATCTACGCTGACGCCGCATGACGAAGATACGCCTGGGTGCCCCGTCTTTGGTCAGAGAGAGGGCGAGAG
TGCCGAATGGTCGCCTAATCATGTGACAGGTGGCGACCACCACTCAGGTGGCACAGTCACGGACGATGTTTCAGAGCGCTCTGAAGCCCCCAGGAATGCC
CAGACGCTGGGAGTCGAACCAGCATACGCGCCTGGACAAGGGTTTTCCAACGGCGCGCCCCATGCCTCTGCAGGCAAAGTCGACTGTGCCGCCTGATCTG
CTGGAAGATCAGCGTGCCACATGCGACATGGTCCAAGGAAAGGTGGCGCCCCAGTACCGCGAGAAGCTCTCGGATCTCATCAAGGGATTGCTGCAGGCCA
AGATCATACAAGTGTCTACGTCGCCATGGGCGTCGCCCATCGTGGTGATCATCAAGAAGAACGGCTTGGACATCAGACTGTGTATTGATTACAGGTTGGT
CAGCAGTCTAACACGATTAATGATCTACCCTATGCCGTTGATCAACGACTTGTTAGAGGATATCGACGCGATCTTGTGGTGTTGTTTCCTTGGATATGGC
GAGAGGATTTTGGGTGGTGACTATGACGGACCGCGCGCGCCCGATCTCAGCTTTCATCACTCCGTTTGGCCTTTTCGAGTGGAACCGCATGCCCTTCGGA
TTGAAGAATGCCCCGCAGATCTACCAGCGGCTACTAGACAATGCTCTCTATGGTTTCTTGCGGATCACATCTGCTTCCGAGCCAGGATCCGTGGTGGATC
TTTTCAGCAATGGGATCCCTGAGGAGAGCGGTCAATCTTCCGCCTTGGGGCGTAGATCTTACATTGACGACATCTTGGTGACTGCGGGATCTCGGGATCA
TCTGTGTGAGCAGGTGCATCAGCTGCTGTAAGCGTGCGACAAGTGGAACATGTCTATCAGCGTGGCGAAGAGCTTCTGGGCCTACGGAAGGTGGAGTATC
TCGGTCATCGAGTCTCTAACGAAGGTTTAGAAGCGCACCCGAAAGACCTGCAACCCCTGGTGGATCTACCTTTCCCGAGATCCTTGCGAGCGATGCAATC
GTTTTTGGGCAGCCTGAACTACTACGCTAGATTCATCGAAGACATGGCGGTGTACGCGTCAGTGCTCTACGAATTGCGCGAGGTGGACTTTGTGGAGTTG
AGATCCAAGGACGGGATCCGGTCAAAAAAGGATCCTGAAGACGGACATGACAAGTGGATCCAAGCTAGAGCTGCGTTCATCGCACTCAAGAGTAAGATTG
CGACGCTCCGACACTTCGACTCCGCGAAGGATCCGGTGATTGTGGTGTACGCTAGCGAGTGGGCTATATCGGCGTCGCTGACGCAGGATCACGAGGGTGT
GTACCTGCCGGTTATGTTCGTGAGTCGATCCTTGAAGTAGAACGAGTTGAACTATGGGATCGTGGAGAAGGAGATGCTAGTGGGCAGACGGATCCGGATT
CTAACTCGACACTCCACCCTGGCATGGCTGTTCCGCTCTTTAGGATTGCAAGGACGCTTGGTACAGTGGGCTGCACTGCTATCGCCCTGGACTTTAGAGA
TCACAAAGTGTACGAAGGGCGAGGACGAGATCCTGGGAACGCTCGCGGCGAGTATTACACCTCGATTCGAAGTGGACAAGGCGTTGGTCAGTATTGCTCC
CAGGAAGGTACGATCCGACGAAGAGCTACTGGTTGCCAGTTTCGATGAATCTGCCCGAGTCAAACGGGGCGGAGGTGCGTATAGTGCGGTCCTCTAGAGG
TTACCTGAGTGGACTATGGTGCGGGCCGCATCTGGTTACGCAGAGACAATGACGGTTAATGAGGCTGCGTACAATGTACTCCTACTATGTTTCGACCTAC
TGGAGAATCTCACCAAGGAACGCCTCACTATCTGCGCGGATTCCAACTTGGTGATCCGACAGACGCGTGGAGAGATCGATTGCAAAGCGCCAGAACTAGT
GCTGCTACGACAAAAGGCTTTGACCCGTCTGCGGACATGGCCGGACCATGACCTAATGCATGTCAAGAGAGCGTGGAACGCCAGTGCTGACAGCTTAGCC
AGCTCGGCACTCCAGCGGGAGAGTGGAGTTGTGGTAGAATTGGAGTCGGACTTCGAAGGTCTAGTTACCCTGAACCGGCTGGATGAGATCCTGATCCCAG
GATCCGATGCAGCCATGGCGAAGATCCATGCTGACACGACCAGGAGGCAAGCCAGAGAAGGACGACCCAGAGTGCTAGACGAAGAGGCTGTCCATCGGTT
GCGAATCGAGCGGATCTGGCAGGCGCAGGATGAGGAAACATGAATCGCCAATCTGAAGGCGTTTCTACGGGGTCAGTTGACGGATCTTAGCGGTGCAGAA
GCCAAGTCTTGCCGCTTGCTAGCTGACAACTTCGAGCTGGACGACTCCGAGCTGTTGTTTTACTGCTCGCCCTCTAGCAAAGCAGATGCGGACCACGACG
GATTGTTGCGTCTGGTGGTTCCGGAAACGCTGCAAGCGGACCTGTTACATCACCACCACGTGAGCTTAGAGGGTGACCACCAGGGGATTGGACGTACCTA
CCAGAGGATCAAGGATCACTTCTACTGGAGAGGGCTGTGCAGATCTGTGCAGAGGTTCATCGGTGAATGCGTCGACTGCGAGACGGACAAGGTGCGACCG
ACCATTAGAGAAGTGTCGCCAGGCAATATCCAGGCCACCTACCCTTTCCAAGTCATAGCCATGGATCATATCCCTTCGCTGCCTAAGTCGATGAAGGGGA
ACACCGAGCTTCTAGTGTGGGTGGATCTCTTTACTGGGTACGTGATAGCAAGTGCCAACGACTCGAGGACAGCTCAGGCGGTTGCTGAATCGTATGAAGC
CTGCGTGTTCCGACGTTTCGGAGCTCGTCAGGTGATCCGGCACGATCGTGAGCCAGGATTTATGTCCGACTTCTTTCGCGCATTCAACAGGATCCTGGGC
CAGCGCCAAAGGGCGACCATGGCCTACCGACCTCAGTCGAACGTATCAGCCGAGCGCATGGTGCAGACGATCATGCGAGCCATCAAGATGTATGTCCAGG
ATCCCGACCAGAGAGACTGGGATGAGTACGCTGAGCGTCTCACGTTCGTGCTGAATACTGCGCAAGATCGGATCAGGGGCGACACGCCCTTCTACCTGTC
TCACGGATGGGATCCCAAGACTATGCTGGAGGCTACGCTGTCTCTGGGGAATACTGGACGCCGCGACGTGGATTCACGTCGCTGGAGATATCAAATCCAA
CGACATTACCAGCAGGCACGAACAGAAGTGAGCGACCGGTTGAAGCATGCCATTGCGGGTCGCGCCGACCGGAACAACGGGGCGGCGACATTGCACACTA
TCGAGGCCGGATCCCAAGTGTGGCTCTTCTTGGACAGGGTCAAGGAAGGGAATGCGAAGAAGCTGGCGCACATGTGGCACGGTACATCCGTGTTGCGGAG
ATGGTGATCGAGTACGCGGTGCGACTAGAGGTTGCTAGGACGGATTACCACCTCCTCCCCGTGGTGCATATCTCTAAGCTCAAGCCGGTCAGGATTTTCC
CTGATCGACCTGGGATCCGACTGACATTCGACGGAGCGGATCGTCTGGACTTTGACGAGGCACTCCTGCCAGAGGACAGTTGGGATCGTGAACCGGAAGA
CGATGAATTCGAGGTTGAACGGATCGTAGACGTAAGAATGGGACGGCCAACTCGATATGGTCGGATCCGGAAGGGGTACCAGGATCCCACCTGGGTCAAC
GAAGTGGATCTGAACTGCGGAACGCTGCTGTACGAGTTTCTCCAGGACCGAAGCAAGCGGAATCGGTTCCAGGCGATGCAGTCGCATGAGGAAGAGTGAA
GTGGTGGAGCCACACCAGCGGGGCGGCCGATGGTATGGCGAGTGACCAAGTGGCCAGCAGGAGGATGCAGGTCAAGTGACAGTGGATATGTGT