Description :
From Genome Similarity Track
Location :
Scaffold_26:35080- 37066
Transcript NameFunction/comments
g4255.t1ETL84095.1 TKL/DRK protein kinase [Phytophthora parasitica

Sequence
1986 bases(100 bases per row)
CATTGTCTGAAAAACCGAGCGGCTCGCAATGCGAGCGACAGCGCTTCCTGCGCTCGTGGCAATGAGCTGGGGTCTAGCCCACAGCCAAACCATCACTTTC
CGGCGTTTGGCATCTACTTCCCTCCCGTCAAACGCGTCGTTCGCCTTCGATGGCACCAATTCCGACATCGCTCAGCAACTTTACATACGCTACAGAGGAG
GCAATACACTGGACGCAGTCGAACTCGAATCAATTCCAGCTGCGGTGGCCGATAGACTCGATCCTTTTCGAATCGCCTTCAACGACCTGCCCGGACTCGT
CCAGCTTGCTGTGCTTTGGGACTCGGGATTCGCCATCTCGCCTGGAAACGAGGCAGTGCAGATGTGGACGATGGACGGCCACTCCATGGCAGACCTCGCC
GTGTCTCGGACAGAGGCCAGCAACGCCGGATGCACATTCGTAGACTGCGTGCAGCCAAACAACGTGACGGCTTCCTACGTCCAGGGCGGGACAGGGGGCC
AAATGCTCAGTGTTTCTCGCTGCGTGGTAGATACGTTCGCGGACTCCACTGCGTCGGAATTCCTGGGTGCGATGTGGTCGAACGGCGGTGACTCCGACAA
GACCCCACACATTCGACTGCGAGATCACTCGTGGACTGACCCAGAGACGAACATTCCGTACAGCGTCTACGCCGTTCACACAGTTCCCAGCACCGACGAC
GTCACGTGGAACCAGTGTCCTCCAAGCGGCGAGTACGCGTCCCTGACCATTCCATGTTACCGTAGAGATAACTTGACGAGCGAAGAGGAAGCTGCGATGA
CTACGCCATCTGGAAGCGCTTGGATAACGACGTGGCTAGAGCAAGAGTTTGCTGAGGAGGACAAGTCTGGGTTTGATGCATTACTGTTAATCCCGATTAT
CGCAGGTGCGGTTGTGGCATTTGGCGCCTTTGGGCTTGGTTGGCTGTGCTGGCGACGCCGAGTCGAGAGGAAAGAGCAGCATGCGAACGATCTGCACGAT
GGCCCAGCAATGTACTGCAATGGAGACACCCCAGAGCTAGCACTCCACCCAACAGACCGATCGAGTCATCAAACCACACAGGAAACGTCACTTTCGAGTG
ATCACAGAAACTACAACAGTGCAGGAGCAAACAGAACGCTCAAGATTTTACTCGGCAGTAAGCATTTAAAAGGGAGACGCCTTCCGTATGAGAGTCTGGT
CTTCGAGCGAGCCATGTCCAAAGGAGCGTCGGGAGAAGTTTGGATCTGCGACTACAATGGGCAAAGCGTGGCAGCCAAAAGGTTGCTGCAGACCAAAGAC
CAAAAGGCAGAAGACGTGCAAGCCTTCGCAGAAGAGATTGAGCTCAGCGCCAGCCTCGTCCACCCTCATATCGTCGAATTTGTTGGTGTGGCGTGGAGCA
GTCTCAACAACTTGGTGCTGGTTCTCGAGTTTTGCCCGGAAGGGAATCTACAGAGCTACCTGCATAGGAATCGAGACTTGCTGTCGTGGGCTCGAGATAA
AATCCACATTGCCGTTGGTGTCGCCCAAGCTCTCGGATATTTGCACGCTTGTACGCCGCCAGTAATTCATCGCGACCTCAAGTCAAACAACGTCTTGCTC
ACAGATAAACTGGAGCCCAAAGTAATCGACTTTGGCGTGAGTCGTGGGCTTGTCGACCTCACTATGACGGCGGGTGTTGGTACGCCGTACTGGACGGCGC
CTGAAATCTTGGAAGGCAAGCGCTACACCGAGAAAGCAGACATTTATTCGTTTGGTGTGGTGTTATCGGAGCTTGACACAGGCAAAATCCCGTACTTCGA
GGCCGCGACAAAAAGGGGAAACACGTTCAAGCCATTTCAGATTCTACAAGGCGTAATGGCAGGGCGTTTACGCCCAAGTTTCGCGGAGGATTGTCCTGCT
CGGATCCAGCGACTTGGGTCGGCTTGTTTAGCGCATGATCCATCCAGTCGTCCATCCGCACGAGAACTAGTGTACGAGCTTGAGGG