Description :
From Genome Similarity Track
Location :
Scaffold_666:3508- 7562
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_666-fgenesh-gene-0.1Endo-1,3(4)-beta-glucanase

Sequence
4054 bases(100 bases per row)
CCGCGTCATTTGCGAAAACGCTCCGGAAGCCACCAAGCACCAAAAGCAGCCACCAACTCCCAGCATCTCCACCACCACCAGCATTACCATGGGGACGTCC
TGCGCCGCGCCACCTTCCGACGCGTTCCGCCGCAGCGACGAGCTCCGCTCGCTCATCACACCACGCTTCCTGCACCCGAATGTTCCTCATGACCGCCCCG
TACCGACCAACGCCTGGTGGGGCAACCTACTCGCATGGGACGGCCAGAAGGAGAGCGACGCGGTCTTCAGCTCGCCATACACGCACAAGGTGGTGCAGGG
CCAGCCCGGCGCGATCGGCTGTGGCTTCTCCGTGAGCTACCTCGCGCAGTACCGCGTGGACGGACCGATGAACGACAACGGCGCGATCCGCTACTACTAC
TACCCACCGACGATCAAGAACCTGCTCTTTTCGGCGCTTGAGCTGAGCGTCGCAAACGGCGCGACGGCTCCACCGTTTACTATCGATGCGTGGGATGATT
TGGGCGTTGTGTTGACACTTGCGCTAGGGCTGACGAGCTTCATGCGCACGTACTTGGCCGTGGGCAACGCGTTCACGACGGTCCAATACGAGGACCTACA
CGTGCAGCTCTGCTCGGACCACGGGTGGCTGACGATCAACGGCCAGCCACTGCGCGATGGACAGGAGTACTCGGGCCAGTCGTTCGTGATAACGTTCAAC
AATGGACAGAAGTGGAACCTGTTCTTCTTTCCGAATAACGCGTCGGCATCGACAGTCATCCGCTTCCAGAACAACAAGCTCACGACGAGAGACAAGTTTG
ACGGGTTTGTACAGGCTGCGTACGTCTCGAACAAGCCAGACGGCGACGCTACGGATACAAGCATCTTGCAGCTCTACCAGCGGTCGGCCGGTGTGTTTGC
GAAAGGCGCGCGTGTGGTGCACGAGGATGGCAACGCCGAGTCGTTCAGCTTTGACTGGAAGCTCGTGACTGTCCCTTCCAAGGAGCATGACAAGCCGCTC
TTTTTGCACTTCGCGCTCGACCATCTGCGCCAGATGTTTGTCAGCTCGTCTTACACCTCATCAGTGGCGCCCAAGCCAGAGCTGACGCTTCACGCGCACA
CGCGCGGCCCCATGCAGGCGTACACCACGGAAACGTCGTCGCCCAAGTGGGAGTTCCGCGTGCCGTTGACCATCAGCGCGGATGTGGAGAAGTACACTGC
ATTCTACCCACCGCAGGCGAGCCTGTCGCCGGACAGAGTGGCGGCGCTCAACCTTTGCCAAGTGCTCAAGGACGAGATTTATGGGGATTGGGACCAAGCT
TTGCCGCACGAAGGCAGCTACTACTTCAAGGGCAAGGCGCTACAGAAGTTCGGCACGATGTGTCTGTTGGCAAAGAAGCTCGCGGAGACCACGAACCCGG
AGATGCACGACGTCGCACAGCACGGCATTGGGCATCTGCAGACGATCTTCAAGGCTTTTGTAGAGAACAAGTCGGCGTACCCGCTGGTCTACGACACGGT
CTATAAGGGCATCATCACCAGCGAGGCGTTCGTGAAGCGCGACATCAACGTGGACTTCGGCAACGCGGTCTACAACGACCACCACTACCACTACGGGTAC
GTGATCACGGCCGCGGCGATGATGCTGCACTTGGGAGGTGACGCATGGAAACACTCTGAGGACGCCGTGAAGCTGCGCATGTTCATCGACACTTTGGTGC
GCGACGTGATCAACCCTTCAGACGGAAACGAGTTCTTCCCTCGCTTTCGTAGCTTCGACTGGTTCCTCGGCCACTCGTACTCGCATGGCGTGACACCCAT
GGCCGACGGCAAGGACGAGGAGTCGACGTCGGAGGAAGTGAATTTCTTCTACGGGGTGGCGCTCTACAGCCACGTCACGCAGAACCAGGCGATGGAGAAG
CTCGCGAAGCTCATGCTCAAGGTCTACTCGCTCGCGGTCAACACATACTTCCTTATCGCGGACGGGAACCAGATCCACCCCGAGGGGTTCCGCAAGAACA
AGATCACGGGCATTTTTTTTGACAACAAGTGCGACTACACGACGTGGTTCAGCCCCAACAAGGAGTGCATCCACGGCATCCAGATGCTCCCAGTGTCGCC
CATCACGCAGGCCGTGCGCTCGGCGCAGTTTGTGAAGGAGGAGTGGGACCAGGTGCTGAGCAAGCTGCCGTTCGTGCACGAGTGGCAGAAGCATGCCTCG
GGCTGGACGTCGCTGCTTTTTGCCAACTACGCCGCGGTGGACAGTGACTTGGCGTGTCAGGTACTCTCGCAATGTCCGATGGACGACGGGCTCAGTCGCG
CCTGGGCGCTCTACATCGCGGCCACGCGCAAGCAGTAAGGTGGCTGTTTGTGAGGACAAGAACAACCTACCTCGGCTTGGTTGACTTTTCCATTGTGATT
TTGGCTTTGCATGTATCTTTGAAACTGGTTTTGGTTTTCGTTCTAACAATTCGGAAGTAATCCATCAATGTGGCTTTACAAAACTGAGTTTGAGTAATTC
GCATTATAACGCTTACGCCTGCGCGAGGGCATTGAGCAGCGACTGCGCAAAGTCGCTTGCTGGTCGCTGGGATTCTGAAGAAGAACCGGACGATCGGTCT
CGAACCATTTTTAAGCTCCTGCGGTTCCGTAGTGATCCAGAAGTTAAACGTCAGATTAGACGGACAAGGCCAGATTTTGCGTGGTGTGGTAATAACTCTC
AAGTCTGACCATTTGAGCGTACCTGATCAACTGTCGGAACGTTTCTTCCGAGACTGCACCGAAGAACTCGGGTATTTTGCCCATGATCGCGCCGACGACT
TTCAGAGCGTTCATGCAAACCTGCCAGGCAGAAATAAGGTATTGAAAGAAAACGGTTAGTGCGATAAACCAGTCGTAACGCAAAATACAATGTATGAGTG
TACCTGTTGGTTGGACGACGAGCTCTCCAGGTGCTCAACCACCAGGCCAAAACACTCGCTGATTAGCTGCATATCGCTGGCGTTCTTGATCGAAATCGTA
TCCGCAGTCTTGTAGATGAAGCTAAACAAAATCTGTGCACAATAACACAATTCAACCACCGAGGAGTCAGTCTCCCGAAATACCAAACCTCGCTTGCGCT
ATCCACCATTGCTTGTTGTTGCACCTGGAAGCACCCGGCAACAACTTCTTCTCTCAGCTGGTTACTTCGCATTGACACGGTCGCAACCAGACGAGGAATT
GCTCGGCTGGCCTTGAAAGTCGCCAAAGTACTCGCGTTGAGGCGTCCAATAATGCTGACACAAATACCCCAAGAAACAGATCCAGCTTAGAGGGGCCAAA
GAAGCAACACCATAGAATAAAGCAAGCATGTACCTTAGGAGGATGTTGCAGCCACAGATGCGCACTTGAAGCGGCAGACTCAGGCCCGCATCATTCTGCT
GCGGGTCACTACCCACGAGCGAGAGTACCATCATCTCGACTGCAAACACCAGCGCACTCGACGCCTTGGGCTCGTCCTCGGCTTGAATGGCGACAGCATT
GTCGAAAATGATCCAGTCCACAAGCACATCTAGCAGAGAGCTAGATGTTGTAGCCCTTCCTGTTGGCTCTGACTCCATGCTGCTTTTAGACTCTCCCAGG
TTCCGCAGAATGAGCAGCGCTACGCAGTCCATGCAGCCCATCTGGAGATCCGCAAGCAGGTTTCTCTCATTTCTTCCACTATTGGTAGGAACACACGGGA
TGCTCAGCACTTGTAGCAGAATCGCGAGGATGAACGGCACCTGGGTCGCGTCTTGGAACACGTCTCCCAGTTCTTCATTGATTATGCGGTTGAGGTAGTA
CACCATCAGCTTTGCCGTGATGATCCCACAGTAGTCTGGAATCTGTAGGCTCTGCAGAGCAGGCTTGTATAGCGACTCGATGAATGCAGTTACTGGGATC
ATCGGCGCTTCTTCTCGGAGAAACGCCAGCAGCTGGGTGAAAATGAACGGCGTCACGCTCGGAGGAGGCAGCTTTGCGAGAATCTCCACGGACAGCATCT
TCACTTCTTTGAACTCCAGTGGGTCGACCACCTGCAGCGCCAGCAGGTGAAAGA