Description :
From Genome Similarity Track
Location :
Scaffold_31:350663- 362027
Transcript NameFunction/comments
Phyci_308249Hypothetical protein
Phyci_65069Hypothetical protein
Phyci_273451conserved hypothetical protein
Phyci_273454conserved unknown protein
Phyci_221281Hypothetical protein

Sequence
11364 bases(100 bases per row)
CTCAATTCAAATCAACGCAACAATGGACTTTTACGAACGCCTCGGTATTTCCCGAAACGCGACGGAGCGACAGATACGAAGTGCTTACAAGCGATTGGCA
CTGAAGTGGCATCCAGACCGATGGGCGAACAATTCAACCAATCCACAGGAACAAGTATCTGCAGAAGAAATTTTTAAACTGTTAGCTGAGTCATATGAGG
TCCTATCAGACGCTGAAGCACGGAAGGCATACGATGCGCATTTGAACGATTCCCCCAGTTTAAAGGACGAATTTGTGCGCAATGGCACAGTAAATGGAAT
GACTCTGGACGAGGCAATTGCTACTTTCAGGGACGTGATTGATAATCTCTCCGGAGCGGTATCGAAGGTAAAGTCGAGCTTTTCCACGCCGAGCTCGACT
GTGGTAAATCCACTTCGTACTCCTTCTTCCGTTCGTAGCGGACTCGTTCCAAACAACCACGACAACATTTTTGCGCCGGACAGAATTCGTGTCACCCGAA
CTGTAGGAATCGGTGCCGATCAGCATGAGCAAGTTATGTATCTTGAGCCGGAAGAGATCATCGCCGGTGATGTTGCAGCACCCACCCAAACAGCAGGTAG
CTCAGGTGCCAATGCCGGATTGCGAACGGTGTCAGTTGTGGGGGGCGCCGTCGCTGTGGGGGCAAGTGTCGCGCTGATCGTGAATGCGTGGTCACAGTAT
TCAGAGATGTCGAGGAAGAAGCGCCAGGCAGCAGTGGTGCGAGACATGCCAGCCGATTGTTTACTTCTATTGCTAGAAGATCACCGGAATACACAGCACA
CCGATACGACACAACTACTTCTCCAACAAGCGGATGAACGGAAGAAAAGGAAAGATGTATCTACACTTGCCATTACTGACTCGAGCAGTGTCACTGGGGA
TAGCACCGCTAAACAGCTTTTCGTTAGAGGTGCCCAAAAAGCCTTGGTCACTCTGAAGCAAGAAGAAGACGCGGCAGAAGATGAGCTGATTGAAGAGTTC
TTTGACTGCGCCACTGAGTATGATAATGCCGCTATGGAGGCAATGGCCGAGGAGGAGTTTTTCGATTGCATGGACCTCATGGATGAAGTGGCAATTCATT
TTAGCGATGAGGCATTGGAAGAAGTAAGAAGAGTGGAGGAAAGCGAAGATGCAGAACAAGCCGTGAATCTAGTAACTAAGCAGATCGCGTTTCCTCCTGG
TTCGACTGTCAGCACTCCGTTTGGCTTGGCAACTGTGCAAGACTGGAGGGAAAGCGAGTCATCAGCAGTTGTTCACTACGCTGCTTCCAAATTCATGGTC
GGATACATTCAGAAATCGGTAATTTCGAGGGGTGCATCACTGGCAAAAGATACAACAAGCAACATTCTCGAATCTAAGAGAACAAATCTAGCGGATCGCG
TGGTAGCTCGCTATCGATTGGATAATGGTGAAGCTGGTAGCACTTTTAAGAGTCTGGTGGCTGCAAGCGGTGATGGTGCTCTGGACAGCGGAATCCGTGC
AGCTGGTGGTGTCGCTCTGGCTAATGGTATGGCAAGGACATCTTCAGCGTTGGGTGGTGCTGTAGCAGCGCCACTTACGATCGCGTCAATCCTCGTGGAC
ATTGGGAAAGAGTACTATGACTATCGCAAGCGATATACTGACCGAAAGTCTCTTGGTGTGCTCTCGACGACCACTGAGCAGCTGATGATGCAGGATTTCC
GACTGAAAACGGGCGAAGTCATCGCTAGTCGTACAGCAGCAGCGGCAGGTGCAGGTATTGGTGCATATAGCGTAGCTTCGGCTCTGGGAATGTGGAGTAC
AGCAGGACTTGCGGCTGGCCCCGTAGGTATCGTGGCGGCCACAAGTGCAGCCGTTGTTGGTGGTATGCTGGGCTTTTTTGCCGGTTCCAAGGTGTATTCA
GCATCTACAGCAGGCTATTTCACAAGTCAGCAAAATGCGAAGGAACATATTGATCGGCTAGAGCTCGGGGCGCGGATTTTGTTTGACGAATTCGACCCGG
AGGCTACGGGCGCAATCTCGAAAGAAGACTGCATCAAACTCATGAAAAAGCTCTACGATGCGATGGGCTCCATATCCGAGACTGGTTATGAGAGAACCAT
GGCAGTGATTCAAGATGATTCGTTTGAAGGGCCTGTGACTTGGGGTATGTTCTGGGAGTGGGTGAGTACAGAAGCGGCTCGAGCGCTTCGTGAGCTGGAA
CATGAAGAGTCGAAGAAATTATCCGAGCCTGTTGCGGGCGAAACGTGGTGGACTAGTTACATGAAGTATTTCTCATACCTGAACTCACAGAAGTCCACCC
CATTGATTGCACCGCCTAATGCAGCCATGTATCCGTCTGTTATCGCGGCTTTGAGACTTGATCTGAAGGATGCAGCTTTGTCGTCGAACAGCACCGAGGT
GCAGGTCGGTGGTGAAGAAGAGAGCTTGGTATTGAAGGCTCAGGTTGAGTTTTTGGTGAACAATGGCCATCTCACGGTTGGTGATGCTTTCCAGCTTCGA
GAACAGTTAGCGTCGGATGATCCTGTGCTCAGAGAGTCTGCACGTAAGACAATTACAGCAATGCATGAAGGCCTTACAGATGCAGCGCCTGACCAGAGTC
TTGTGTGCGACGGATTTGGGTTCACCGGTGGCGATGCCATGGAGATTCCAGCTGACGAACCCGAAACGAAGGAGGCCTCTCACGCACAGGACACGAGGAA
TGGAAACACTGCAGCAACCACTGGAGATGAGAAGAAGAAAGTCTCCGAGCCAGATGATCGACTTGATGTCATGTGCTCACTGATGTCAACGCAGGGTTTG
CAACGTTTCTTGCAGCGACAGAACATCCTTGTTCCAAGTGGAGATGAAGCGCCTGTACGACACGAAGACCTGCATTGTTTAGCATTAATGGCAGGGCCGA
GCTCGTAAACATTGTCGAGTTGAAGCATTTGAGTTGAAGACTAATGTGAATCAAACACAAATGGAAATACATGTATCCTGATACCAAGGTATACTGATTC
ATCGCACCATCAATCACCTTCGTGGCATTGCCCCAGATTTTAGTCTTGGTAGAAAGCTGGATGGATTGTCCAGGCCAGTCATAGGTGAATCGCTAAGAGG
ATGCTGCGCTCAGTCCATGACGACCATCACCAACAACTCGAAATAGGCTTCGCACGAAACCCGTTCCAAGAACCCCCAGGTCCGTTCGTTACTTGGAGTA
GCTTGAGGGGCGCCATAGCTGGTGTATTGCGGTGCTCGGTTGAGAGTGAAGCAACAAGAAAGAAGGCTATGGCCGACGAGAAGGGATCCGATGAGAGCAA
GGATGCCACCTCGACGTAAGCACCTCGTGCATATTGGTGCTCGGACTAGTTACTTATAAGGGTTTTCGTGAACGGCAGGCCTCGTGTCATGAAAGCGCCA
CCCAAGATGGCCCCACCTCCAAACGCCAACGCAGATGCAAAGGTTCGCGAGCACTAAGCAAGTCTAAAGCAGTTCTAACCACTTACTAATTACCCGTACG
CTTAAGCAGGGTGGACCGAATGCGGACCCCACGAAGAAGAAGAAGGCGTTGCCACCGCCGTCAAATCCTCCACCAAAAGCTGGGGGTTCCGCGGCAGCGG
CATTCCGCTCAAAGTCCTCGTTGCCACCGCCTAATGGTCCTCCTCCGGGTGCAGGCGCTCCCAGTGCTTCTGTCGCGAAGATTCGCGGAGCAGCACGACC
TCCGTCGGGCTCACCACCTGGTGCAGCTCAAACCAAAGCAGGGCCCCCGCCGAATGGTCAAGCGAAACCAATGGGGCCTCCATCGTCGGCACCCCCCACA
GCAGCTTCATTAATGGGGCCACCATCGTCAGCTCCTCCGGCAAAACCGAATCCAACTGGAGCTCCACCGTCGACAGCTCCACCTAAAGCAGCAGCAAAAC
CTCCGATCACTCCACGCACCGGTGAAGTTGAGAGCAAAGGCGAGACAAAGGCCGCGCCTGCAGGACCTCCGAAGCCCAAACCCGATGCTAAGCGAACTCC
GCCAACGTCAGCGAGGGGTCCACCGGTAGATGCAAAATCTACACCAAGAGCAGCCCCAGTCGATATTCTAGGGGACGATTCACCTGCGATGGCGAGCAAC
TCAGGGGCCCCAGCCAAGACCAACACAGCTGCAGCTGGCAAGCCTCCGAAACCGGTACCGCAAACCCAGCGTCCTCCCGCTACAGCTCCTGCAAAGGCCC
CACCTGCAGACAAACCACCAGTTGTGAAACCTCCTCTGGTGATGAAAAGCACAATGGAAGTGCTCAATGACGCAAACGCAGCGTTATCAGCTCGTAATCG
TGGCTCCGAAGAGGAAAATGAGCTATCTCACCGGGTGAGCACGCCTTCTACGAAGGAGAATCCTGGTGTTTTCACGACCAAAATGGGCATGGCGGCGCAA
TTCAGCGCCCAGTCCAGGCTCAATGTACCCGAGGAAGAGGTTATTGTCGTCAAGAAGCGTGAAGCGAAAAGCACTGAAGCGGAGGCCAAGCCGAATGTAA
GTGCAAACGCGAAATCGTCGCGGCCGATCGCCAACATCGATGACTCGTTTGAAGACGTGGAAGAGATCCCGTTCCTAGAGGATGGCAAAGCTGATGCGAA
GGCCAAAGATGACCAAGAAGAGAAGACTATCGAACACAACGATGATCCCGAAATTGTCATCGAAAGCAAACACGGCCCAGCTAAACCAAGTGCCAGTCGA
TCCACTTCTTCGTCTCAAGGTGATGCTAGGAGTGAGCACAAGGGCAACAACTTTGACGAGGAAAAGGAAGATGCAGAGGGTGTGGTGCGGAGAAATGCTA
CTCATGAGGACATCTATGATGAACTACGGAAGATGAAGCGCGGATCTCACTCTCCTCGTGAGGACGATAATACTGGTAGCGATCATGAACGTGATGAACG
TGATCGTGAACGCGACCACGAGCGCGATCACGAACGCGATCGCGAACGTGACGACTCCCGCTCTTCCTCCTTTAGTGATAAGAAGGATAAAGGTAGCACC
AACAGTGACGAAAGCACGAACGAGCAAAGTGGTCGAGAAGGCAGGGAAAGCAGAGACCGAGACAGGGATCGAGATCGGGAGAGATCGCGTGAAAAACGCA
AGGACAGGCGACGTAGCAAGCAAGACGAGCCCAAGAAGATTCAAGCCCAGGTATGCGCTTCATTTTATTCTGGAACGATGCTTGCCTATGCTCATTACTA
TCCTTATACCCTTGTTTCGGCTCTCGCAGTTCTTCAATCCAAAGAGCGTGCCGTATATTCCGGATCATTTGTTGGAGTTCGTGAAGCGGCCGTTAGATTG
TGGGCGCGGTCAGATCGTCAAGTGCTTTATCGAGAGAAACGACAGCGGTCCGAACAAAATCGCTCCCATTTACACCCTTCTGCTGGAGGTTAACAGCTCC
AGTGGTCGCCCAATCATGTATGCGAGGAAGAAAGCTACTAGCCGCATCACGTCGCACTATGTTATCTCGATGAACAGGTGAGAGCGATGTGGTGGTCGAG
CTGGATCAAAGAAAATGCTGACTTGCTGTGTTGATTTATACTTCAGAGACGATCTATTCCTCTCACGAATGATGCGGAGTCACCAATACGTCGGCAAGCT
ACGGTCGTCCACTAGCTTGCTTGAGTACTGTCTGTACGATCAAGGCGACAATCCTGAAGACTTGGACTCGGACTGTGAGGTTGACGATGAGATCAGACAA
AGCATCCGAGCTGAGCTCGCAGTGATTCGATACCACAATTCCAAGAAGGTTTGCTATCTCATATGTTTTGTCAAGTGACGAAACCGTGACCTAATTGTTT
GGCATGCCACGCAGCCATATCCACGAAAGATGGAGGTGGTGATCCCAGCTATCCTAGAAAATGGTCAAGGTTACCTCGAATGGCGACCTCTTTCTCGTGA
TCAGATGATGGAAGAGCACGTCCGCAATATAACAGCAGCCGTACGTGATCAACCTGCTCAAAGTGTGAAGCCATCCATCGTCTAATCGAGTATGCTGCGT
GTTGGCAGGGCGGTCAAAACGTCATGGACGCGTCCAACTTCGTATTCCTTCACAAGCGCGAGACCAAATACGACCCTCTCTCGTCCTGCATCGTCGACTT
CCGTAGCCGTGCTACCTGTGTATCCGTCAAGAACTTCCAACTGGTCCACTCCGAGCCGACCAACGAGCAAATGCGCGACCAATACCGCAAGGCGTATCCC
GACTTCGTGTACGAAGACCAAGGCACCGTGTCGCTACCGCAAGAGTATGTACTGCTGCAGCTGGGGAAAGTGGGCAAGGACTGCTTCAACATGGACTTCC
AGTACCCGCTGTCCATGCTCCAGGCCTTCGCCATCAGTCTCAGCCGGTTTGACACCAAACAGAGATAAACTCGTCGCCGACACCAAACAAGAGGTAAACT
CGATAATGAACGATAAAAACTCGACAACGCCTACAATACTTAGCGTTCCAGAAATGCTACCATGAACTGATCTCGTCAGCAGGTTGAGCAATACCTCCAA
ATAATAAGAGATACGAATGAATACAGATTTACCACATCATCAATGTCGTCTTCGTGTTACATGTTCATCCTGCTAACTCCGCGATGGATGCAAAGGATTC
AGTCATCGCTGACTTGTTCACACGAGTGCCATGGGCCTGTGTTTCAGAGGAGAAGACACGTCACCTTTGATTTATTGCTGCATGTGGTCGTGCCACTCGC
TGCTGGTGTGGCTGCTTAGAAAATAGAGAGCTTCACTTCCATCGCCTCGTGGACGCGGAACGTGTTCTCAGGGTGCTCGTTGGGGTCTGCACCAACAAGA
AATCACATGCATCAGTCTCGATGCTGCCCATACTAGCGCAAACCAAGAGCCCCCACGTACCGTTAAGGAAGTCCGTGAAGTCGATCTGCTCGTCCGCGCC
CGTGAGCGTGTCCAGGCCCGCGTGCGAGCTCGGGAGACCTGGGAGACGCTACAGCCACAGCAGCACATCACCCAACCGTCAGCATTTCTTGAGCTTAAAG
AGGACATCCAAGGCTGGCTAGCTGCTCACCGTGAACTGCTCGAGCACCGCCTTCTCCGTGCGCAGACGCATGGCCGCCCCCTTGCCGTAGACCTGCTCCA
CCGTCGCCATCTTGAGCTCCCAGTTGGACTGGCGGTGCTGCAATGCAGCCAACCAACACCCGACGCAGCTCTTAGCATAACACTAGTCCACTATCCATCG
ACGCAGCTCGAGCGGCGAGCGTACCGTGGTCTGCAGACGCTGCACCTCGTGCACCGGTCGCACGTCCTCGCTGGCGCTGTAGAAACCGAAGCGCAGCGCG
TCAGGGGGCGCGCGGACGAGGGGGAGGCTGGCAGAGTTCTGGGAGGAGGTCGGTCGCGCATACAAGGCACAAAACGTCAGCCCTAGGTGCACACAGGGCC
TGGAAACAGAGGCACACGAAGGCTCACCATGTTGATCTGGGCTTCTTGTCGAGAGAGATCCAAAATGGGGGATTCGGCCACGGATTATCCTGTGCAATAG
CATAATATGCTAGAGGGTAGGATATGCGATGTAGCCATTCGCTCCGCATTGACAGACGACGAGCATGGCGCCCGGCAGGTCGCACGGCACCGACGAGTAC
GGGCTCAAGCGGTCCTCGGGCGTGGACTACAACCAGGTGCGCGACCGCCAGATCGACGACCACCGCTTCGAGCGGCAGCGCGCCATCCGAGCGGCGTCCG
CAGCGGTACGAGCCTGTATCAATGTGGTATTAGTGGCGCATTGTGGTCGCTGAGCCTGTGTGGGTGTTTATATTGTGTACAGCCGCCGCCAGTGGAGAAG
CCCAAGCATGCGGGGGGTAAAGCTGCAGCGCCGCAGTCCGCCACCATGGACGCCTTCATGCGCATGGTGACGGGCAAGGAGGAACGCACCATCGCCGACC
GCATCAGCGACCCGAACCGCCCCACGTGGGAGCAGTACAAGAAGGAGAACGCAGACAAGCTGGACCTGAACGACAATGGGGAGAAGGAGATGAAGGAGTA
CAGGAAGAAGCTGGACGCCGCCAGGGAGAAGGTGGGTGCTCTGATGACCTCTTCCTTGGCAGTAGTGGAGAGGTGGCGCTCTGATGCTGTGGCTGTTGTT
TCTGCAGAGGCTGGCGGGAGGCAGCAGCTCCAAGAAGAGGAAGAAGAAGCACAAGAAGCGCTCGCGCCCTTCATCGTCGGAGGATTCGAGCAGCGAGGAC
GAGCGCCGACGCTCCAGACACAAGAGTCGCAAGAAGAGGTGAGTCGGTCGGCAACGGCGTTGTCGTCTTGCTGAGAGTGCAGCGTCTGATACAGCCGTTT
GACGAGCAGGAAGAGCCACAAGCGCAGAAGGGGATCCTCGGACTCGGACGACAGCGACTCGGACTCGGACGACGACCGCTCTCGACGACACAAGCGCTCG
AAGAAGAGCAAGAAATCGTCTCGCAGGAAAGACCGGGACGCGTCTCCCTCACCCGTGCGCCTCTCGTCATTCCTGCAGCAATCGAGCGACGAGTCGGACG
ACGAGTCTTCTTAGCGGACGATCAGCGCGAGCATCAAGCTTCCGAGCGTCGTAGCCGCAGCCGTGTCTCTAGAGCTAATAATCCACGTTGTTACAACGAC
CACATGATATCTTGACCCCCATTTCTGCTCGCCGTCCTTGGAGAAGTTCAATCGACGACGCCTTGCTCGCTCGCTCGAGGTCTATCGGACCCTCCCAGGC
ATCCCCGACACTGCGCGATGGCCGACACCGAGGACAGGAAGAAGTTCATGCAGCTGCTGCGGCAGGGCGTGCAGCACAAGGTCCAGCAGCAGCAGAGCAA
AGCGGTCTCAGATTCCGCTGGTGAAGGCCCGAAAGATCTTCAAGCGCACGGGGAAGTGCGGCGCGCTACACTGCCAGAGCGCTGCGGCAATGGCGAGGAG
GCCGCGGGCGTAGCGGCCTGGCAGACGCTGGCGTGGCGCGACGCCTACTCCATGGCGCCGTATTTCCAGGCGACAGTGGGCGGCAGGCCACTGCGCATCA
AGCAGGTGCTGCAGGGGGAGCTCAACGGCTTCGGCACGGGCCTCACTGTGTGGCCTGCAGCCTGCGTGCTCTTGAAGCACCTGGAGCAACGAGTCGCTCG
CAACCCGCGGGCGCTAGCGGATTCCGACAACCCGTTCGTGCTGGAGCTTGGCAGCGGCACGGGCGCGGTGGGCATCGCCGCCGCGATGCTGCTTCCAGCT
GGAAGAGTGGTGCTGACCGACATGGGCAACGTCCGCTTCATCATGCGGGAGAACGCCGAGCTGGCGCGGCAGGACGGCGTCATCAACAACCACGTTGCTG
TGGATGTGGAGGAGTACGAGTGGGGCCAGCCTCCTTCGGAGAGCCTCATCTCGTCGCCCGACGAGTCCTACCCAGACCTCATCCTGGTGTCGGACTGCAT
TCTGCCACGGCTGTACCCGATCGAGCCTCTCGTGGAGGCTCTGGTCACGCTCAGTGGGCCTCGCACGTGCATCCTCATTTCGTATGAGCATCGTCACTAC
CAGCACTTTCAGCCCAAGCACAGGTTCTGGGAGCTCATGCAGGCCCGAAAGTTCTCGCTGCGGGTGATCGACACGACGGAATACCATCCTCACTACGTTG
CTGCCGACATCGAGGTGTGGGAGATCACTCCGCAACAGGCGTGAATTTCATTACCGCTCACGTACTGTGCCTTAACGCTACTTGATGCACATGGCTACTT
ATTTACTTACTTTGAAGCCTTCTTGTCCTCTTGGTTATTGCTTGACGAAGCCGGTGGCACTGCTGAAGCGAGCGCTAGGCAGTGCAGGTCCTCGTGGCGT
GTCATTGTTTCGTCTTCTGGAACGATATACTGCGACTCGAGGAACTTCTTGAGCCCATCGGTGGACATCAACGAGCACATGACGTCGAGTCGTGGGTCGA
CCTGTGGCGACTTCGATCCTTTTTTCTTCTCATCAGCAGAACGAGCCAGAGGGGGCAGCTTGGTCAAGGCTGCCGACTGCGATGACACGATCTGAGTAGT
CTTCACTGTCACTGACAGCGGGGCTGGACTGCCTGTTTGGCTTTTTTCCTCCACCTTCGCGGCACTCTTCACAGCAGGAAATGGTTTGTCGAAGCTGTCA
GGGTTTTCAGATTCAGGCTCCGGATCGGCTAGCTCCGCGTGAAGAGCTGCAATGATTTCTCGGGCTGACACCTGCTCAACAGGGTCACTCGAGTCCAGCT
GGGAGCAGAGCGAAAATGCCTGCCCGGCCGTCAGATGACGGCTATGAACGAGAGCCTCGACCGTCGCCTTTACCTCATCGAGGTTATCTTCTTCGCCGGG
GTGGACAGGAGCAAAGGCCGCTCGGGCATGAATCTCTTTTTCCACTTCTTCGAGACTTGCCCTCTTCGAGGTTGCGTTGGTAACTTTCATTTCGCTTGGA
TAATGCTTTTCATGCTTTTGTTTCGCTTCCTTAAGTTTTCGGAGGACCTTGTCCCGCTTTCTTTCACCTTCACGTTCAGCTTGGTCCGTCGGCTTTGATG
CCTGATTCTCGAGGCTTTTAAGTGATCGCGCTGCCTCCGTACTTACCCAGATCCAGAACATACGCCACGTCACCGGTCCTTCAAAACTGGGATCTTTAAT
CGCTTCAACGGAAGCCTCGTACGCGAAGTCTGATGTATCTCCTGATATTTCATACAGCTTTTCCATGATGGAGAGACAAGCCTCCTTCGAAATCTCGCCG
GTTCCTGTGGGGTCATGTTCCTCAAACAAGACACGCGCACCTAGCTCCAATCGGTCAATGTGCTCCTTTGCATGCTTTTGGCTCTTGAAGTGCGAGGCAG
TTGATAACGAGTACACCTTGGCGCCACCAAAGTAACCTGCAACGCCACCTACAACGGCAGCACTTGTCGCCGCCACAATCCCAATAGGTCCCGTAGCAAC
ACCGGCAGCAGCCCACATTGTCATCGCTGACGCTACCCCGTACGCGCCAAGTCCGGCACCTGCAGCAGCGGTAGTGCGGCTTACAACGACCTCCCCAGTT
TTCAAGCGAAAATCCTGTCGCATTAGCCGCTCACTTGTCGACGACAACACCCCAAGCTCCTTTCGCTCAGTGTGTTTCTTGCGGTAGTCATAAAATTCTT
TTCCGATGTCGACAAGAATGGACGCAACAGCTAAAGGGGCTGCTACCATTCCGCCAAGAGCAGTTCCAGATCTTGCCACTCCATTAGCTAGTGCCAGCCC
ACCAGCTGCGCGAAGGCCACTATCGACAGCTCCTCCTGCACCAGCAAGAGCCACACTTGTAATCTGGACCCCGGTTTTACTTTCTTCGAGACTATACTTC
GTGATCACGCGCTCTGCTAATTCTGCTCGTCTTTTCTCCACCACATCATTTGCCAACTCCAGAG