Description :
From Genome Similarity Track
Location :
Scaffold_48:350540- 355887
Transcript NameFunction/comments
Physo_118023hypothetical protein
Physo_136822reverse transcriptase
Physo_136823hypothetical protein

Sequence
5347 bases(100 bases per row)
TCCCGTACAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCA
CTGCCTCTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGT
GCAAGCAAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGTCACAAGCAGGCTCGTACCCCCGCCGCGGTATGGCAGAGCAACCCT
GCCTCTGGCGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCT
ACGGCTGTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAAGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCA
GAAGCCGCGCCCCAGGAACCAGGAGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCG
CACGCCATGGGGACTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCCGGATACGA
TCATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGATTGTCGCACGCAATCGCGACAAGTACGCCGATGTGCTACGA
GGCAGCAAAGGCAACGGGCTGGTCTCGGTATGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACT
TCGACAGCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCG
CGGCAAGGCCATCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCAC
CAGGGCGCAGCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCTGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCA
CCTACCAGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGATAACCA
AGTTCCACGCGAGGTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATA
ACTGATGCGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGTGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTT
CCGCTCAAGAACAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGCGAAGATCGGTGGTGCCGTCAAGGCGG
CGCCACGAGACGAAGACACCTGATGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGC
TCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAG
TTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGG
CCGAGTTGAACTCGTCCTCGGTCATGGAACAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCG
GGACCCGGTGTACCCCTTGGTGAAGGAGTTTGAGGACGTGCCTGGTGGACGGATACTACCAGGTCCTGATGCGCGAGAGCGACATCCCACTCACGGCTGT
GAGCACGCCCAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGA
CCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGAAGGCCATGGAGATGCATCTCCAGCACCTTC
GACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAG
CAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCC
AACTAATAGTGTAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCACTGGGAGCGTCGCCATCAAGATGCTTTT
AACGACATCAAAGCGAGCTTAGTGTCCAAGGATCCACCGTCCAATCTCCCTCTGGACAGGGGAATCAGGCACGAGATCAATCTCGTGCCGGGCACGAAGT
ACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCGTTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAA
GTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCG
CAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACGCCAGTCCTGGCATTGCCGGGCGAGACG
AAGTCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGACTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGT
CCAGGCAGCTCAAGGCAGCCGAACGGAATTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGG
CTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCAGATGGCGCGTTGGCTGTCATTCTTC
GCGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTC
GGGTCACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAA
GGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGT
ATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGTTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGT
CTGTCTTGCAGATGTTTTGGTGGCGTCATATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGTGAGACGTGCCAGCGCGTGAAGCCGCCGGTCACGCC
TCGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTG
GTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACATTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTG
TGTCTTCCGACACCACAGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCAAGGTTCGCAGCTACGTTCTGGCTGACGCTGTTTCGCCTTCTCGGCACA
CGACTGTCGATGTCGACGGCGGACCGCCCGTAGACGGATGGCCAAACGGAGCGCGTCAAACGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGA
TGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAATAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGATT
GCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGAC
GTGAGTCCAGCCACCTTGTGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATACTCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATA
AACAGAAGGAGTATTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACAC
TGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATATACTTGCCCAAG
TCGATGACGACTCATCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCCGGAAGCGGTGGGTGGCCCGGTGG
AGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGAGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGTACATCGGAGCAGCATACGCAGGGGCCCC
GTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGGGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGG
TTTCACAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCC
GCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACG
AATCTCCTCTTGCTGCAAGGCCACCACCTGACTCGGAGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGT
CCTCCTTGATCGTAATGAGTTGAGCGAACTCGATGCGGAGCTCGCGC