Description :
From Genome Similarity Track
Location :
contig_37:350535- 352252
Transcript NameFunction/comments
g9379.t1XP_024582078.1 mitochondrial inner membrane protein oxa1 [Plasmopara halstedii
g9380.t1RAW25776.1 hypothetical protein PC110_g17817 [Phytophthora cactorum

Sequence
1717 bases(100 bases per row)
ATATCGGGAAAGTATAAACTTTCTCGAGCTTCACGCCGTCCGCCTTGCGATCCACGACCTGCATAAGTTGGTACTCTGCATCCACGAAGTACGCGACGCT
GGCACCGAAGCTCTTGCTCAGGAACGGATCGGAGGCCAGCGCGTTGTGGTGCACACGCGACTCCCATTGCGCCTTGCGCATGCTCAGGCTCGCGTCCAGC
GGCGTCAAAGCCGGTACTGGCAGAGCAATAGCGCGCTTATCGATCCCATCACTAGCCAGCACGTAGCTGTCGAAGTCCTTGTCGATCAGCGCGCGGTCCA
CCTCCATCGCCATCGTCAAATGGGAGTCTATCGAATCAACGTTTACAGGTCTTGTGTAACCATATAGCCTCTGTAATATGCTGGAGGATACGCATAAAGT
GTGACAGGAACAGTCGGCGGCGCTTGATGCACTTGTGGATTCGAGCAGCGATGACGGAGCCGTCGGTTGTGGCAGTGCAGCACCAGATCCGCTCGAACGC
GTCGCAGCTGCAGGACTACTTCTCGGACCTGTACGCATGGGAGAAGAGTATCGACAAGGAAGACTCGGCGCGGAAGCGAGCGGCGAGGACTACCAAGAGT
TTGGATGCAACCCCACCGCCACGAACGGCGACAGTCGTTGGTGTTGGCAATAACAGCGAATCGAGTGGAGAAGGAGATGCTACTGATGGGAAACAACCTG
GTGCACATACCTATGACAAAGGATACAAGCGGTGGGAGAAATTCGATGTGGTAGGCTGCGTCTTTTGCTGTTGGTGACGATTGAATTGGCGACGCTGAGT
TTCTGGGGATATGTGCAATGATTGTTGTGCAGGACGCAGCATTGAGAGAAGCGGATGGAGGGGGTTCTGCAGTGCCAATAGTTGAAGATTCACCAGCGTC
GTCAGTCCCACGTCGGGTGGTTGTGATGGCCCAATCTGCTGCGTCTTCGGCAACAACGAAAAGCCGGGAGGAGTTGGAGAAGGAAGAGGGCAATGCGCAC
TACAAGCGTGGTGACTATGTGGCTGCTGTCAAGAGCTACACGCGCTGTCTAGGCTACAACCCGCAGAACGCGGTGGTGCTGTCAAACCGAGCGATGGCGT
ACCTGAAGAATCGCGAGTTTGCTAACGCTGAAGACGACTGCACGCTGGCGTTGAAGGCCAACCCGACCCACGTCAAGTCGTTCTCACGTCGAGGTACTGC
CCGCAACTCGTTAGGAAAGCACCGACTCGCGTTGCTTGATTTTCACCGCGCTGCAATGTTGGATCCGAAGAGCCGTCAGATTCAGACGCAGCTTCAGTCG
ACGCGGGACCTCATTCGAACCGCTATCAAACGTTCTCCAAAGCGCACGCAGTTTTCCATTGAAGTAGTTGGTGAGAGTTGTCTGGTCAAGCCAGAGGTAG
GCAGTGAAGCGCTCGAGGACAAGGAAAATCTTGGTTTCGCACCAGCAGGTGAATCTATCCGCGGACTTTACTGACACGAAACACCAGCCTTCTCCACTCC
AGGAATCAGGCTTGGCTTCGGCATCTCCACCATCTTCAACCACGACGTCTGTACAGACAACGCCTGAAAGCAAAAAGAAGAGGATGTTGGCCATTCTGCC
CAAGCTCCCGAAGAAGGCACCGACCACTTCGTACGAATTCGGTCGAGTATGGAAGACACTTGCCTTGCGTGGAGATGCCGAACACAAAATCCGTCTGCTC
AGCTTACGCGCCGACTA