Description :
From Genome Similarity Track
Location :
contig_37:350508- 352225
Transcript NameFunction/comments
g8950.t1XP_024582078.1 mitochondrial inner membrane protein oxa1 [Plasmopara halstedii
g8951.t1hypothetical protein

Sequence
1717 bases(100 bases per row)
CCTGCACCGTCACATTCTCCTGTCTAGCCGTCAATATCGGGAAAGTATAAACTTTCTCGAGCTTCACGCCGTCCGCCTTACGATCCACGACCTGCATAAG
TTGGTACTCTGCATCCACGAAGTACGCGACGCTGGCACCGAAGCTCTTGCTCAGGAACGGATCGGAGGCCAGCGCGTTGTGGTGCACACGCGACTCCCAT
TGCGCCTTGCGCATGCTCAGGCTCGCGTCCAGCGGCGTCAAAGCCGGTACTGGCAGAGCAATAGCGCGCTTATCGATCCCATCACTAGCCAGCACGTAGC
TGTCGAAGTCCTTGTCGATCAGCGCGCGGTCCACCTCCATCGCCATCGTCAAATGGGAGTCTATCGAATCAACGTTTACAGGTCTTGTGTAACCATATAG
CCTCTGTAATATGCTGGAGGATACGCATAAAGTGTGACAGGAACAGTCGGCGGCGCTTGATGCACTTGTGGATTCGAGCAGCGATGACGGAGCCGTCGGT
TGTGGCAGTGCAGCACCAGATCCGCTCGAACGCGTCGCAGCTGCAGGACTACTTCTCGGACCTGTACGCATGGGAGAAGAGTATCGACAAGGAAGACTCG
GCGCGGAAGCGAGCGGCGAGGACTACCAAGAGTTTGGATGCAACCCCACCGCCACGAACGGCGACAGTCGTTGGTGTTGGCAATAACAGCGAATCGAGTG
GAGAAGGAGATGCTACTGATGGGAAACAACCTGGTGCACATACCTATGACAAAGGATACAAGCGGTGGGAGAAATTCGATGTGGTAGGCTGCGTCTTTTG
CTGTTGGTGACGATTGAATTGGCGACGCTGAGTTTCTGGGGATATGTGCAATGATTGTTGTGCAGGACGCAGCGTTGAGAGAAGCGGATGGAGGGGGTTC
TGCAGTGCCAATATTTGAAGATTCACCAGCGTCGTCAGTCCCACGTCGGGTGGTTGTGATGGCCCAATCTGCTGCGTCTTCGGCAACAACGAAAAGCCGG
GAGGAGTTGGAGAAGGAAGAGGGCAATGCGCACTACAAGCGTGGTGACTATGTGGCTGCTGTCAAGAGCTACACGCGCTGTCTAGGCTACAACCCGCAGA
ACGCGGTGGTGCTGTCAAACCGAGCGATGGCGTACCTGAAGAATCGCGAGTTTGCTAACGCTGAAGACGACTGCACGCTGGCGTTGAAGGCCAACCCGAC
CCACGTCAAGTCGTTCTCACGTCGAGGTACTGCCCGCAACTCGTTAGGAAAGCACCGACTCGCGTTGCTTGATTTTCACCGCGCTGCAATGTTGGATCCG
AAGAGCCGTCAGATTCAGACGCAGCTTCAGTCGACGCGGGACCTCATTCGAACCGCTATCAAACGTTCTCCAAAGCGCACGCAGTTTTCCATTGAAGTAG
TTGGTGAGAGTTCTCTGGTCAAGCCAGAGGTAGGCAGTGAAGCGCTCGAGGACAAGGAAAACCTTGGTTTCGCACCAGCAGGTGAATCTATCCGCGGACT
TTACTGACACGAAACAGCAGCCTTCTCCACTCCAGGAATCAGGCTTGGCTTCGGCATCTCCACCATCTTCAACCACAACGTCTGTACAGACAACGCCTGA
AAGCAAAAAGAAGAGGATGTTGGCCATTCTGCCCAAGCTCCCGAAGAAGGCACCGGCCACTTCGTACGAATTCGGTCGAGTATGGAAGACACTTGCCTTG
CGTGGAGATGCCGAACA