Description :
From Genome Similarity Track
Location :
contig_60:350506- 351617
Transcript NameFunction/comments
g9119.t1hypothetical protein PHYSODRAFT_552275

Sequence
1111 bases(100 bases per row)
TCCATTACGCGCCGCACGTAGTCCACAAGCTCAGCCGAGTAATATTCGGCCACCGAGATCACATCCTCCGATCCACACTGATGGATGCGCGTAAGCGGCA
CATCCAAAATTGACGCAAATTTGAGGAACATGGCACGCAGCAGGATAACAGAGGACGGGTCATTTTTCACGCGCTGGTGTAGGATCTTCATGAAGTCATT
GATAACCTCCCAGGCATACGACAGGTCTGACACGTTCTCAATAATGCCCATAACCTCGTCTCGAATGCGGACAGTGCGCACCATCTCGGTGAGAAATTCC
CGCGACTCCTCCAGATATGCCTTCACCTGTAGGTTTGTGTCAATCTGGTCAAACTGCTCAACGTGGCCCAACGCCTCGATCAGGCGCTTAATTCGCCGTC
CAGCTTTAATGTGATCCACGTAATCCAGGCTGTTCACCTTTTCAGCCAAGTCCTTGAACCACTTCAAGAGATCTTCATTGCGCTCCACACGAGTCAGTGG
CTTCTCTCCGGAGAAGTATTCGCTGAGTTCCTCCATGCGCTCTGATGTCTCTTTCATGCAGCGCTGCCACCGGTCTTCTTTACTAGCTAGCAGTGCCTCG
AACATTTGCTTTAGCTTCCACTCTAGCTGCGAGACCTTCAACAGCAGTGTGATCAACTTGTCCGGATCTGTGCCCTTGTCGAAGATCTCGCGCTGAGCTG
TTGAGTTTTCCATCAAAGGAATCGTTGGTTGAATTCGAGAGTGCATCATCGTCCAACGGATTGTCACGTTGGCATTACGGATGCAGTTCAGTAGCGGGTC
CAGGTTTTCCAGCACGTACATTTCTGTAAGCACGCCTTCCGTAAGGAAGTAGTTGAGCTCATCGATGGACCGCTGTGTTTGCTGTGCCTTCTTCTTGGTA
ATGTGCGCGATATTCGACGGTTCCAGCGTGTTTGCGAGTGCTAAACGCGCCGCTGGATACGCCGCCCACTCCAGCGATAGGTCGGCTACTGCGCCCATGT
ACGTTGTCAGGATAAAGTTATCGTTGAAGTGGCGATCCACGATTTCGCGCATACTTGCCTTCTCGTGGATAAGAATATCCGGGGCGAAGAACAGAATCAC
AAACAGCATTG