Description :
From Genome Similarity Track
Location :
Scaffold_600:3504- 7731
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_600-fgenesh-gene-0.1Vacuolar protein sorting-associated protein 35
Pytve_DAOMBR484maker-pve_contig_600-snap-gene-0.13Conserved gene of unknown function

Sequence
4227 bases(100 bases per row)
ATGGAGGCGGCCAGGGGGTTCGTGCTGGACGAGCAGGGCGAGGCGGACCTGCTGCAGGAGGCGCTGCGCAACGTGCGCGACCAGGCCTTCCGCATGAAGC
GCGCCGTGGACGCCGGCGAGCTGCACGCGGTGCTCAAGCACGCGGCCGACGTGCTGCGCGAGCTGCGCACGAGCCTGCTCTCGCCCAAGAACTACTACCA
GCTGTGTGCGTGTTGCGGCGGCGGCGATGCAGGCGCTCTGCGGTCGTGGCGGCCCTACTGACTCCTCTGTGGCCGGTGCAGACATGCAGGTGCTGGACGA
GCTGCGCCACCTCGAGAGCTACTTTGAGGAGCTGCATCGCTCCGGGACGTCCGTTCGCTCTTTGTATGAGCGCGTGCAGAGCAGTGGGAACGTGCTGCCG
CGACTGTAAGGAGACGCCACGAGGACTGCTCGCACGGCTCGCTTTGGTTGCTAACCGCCCACTCGATGTGTTGTGAACAGGTACCTGCTCGTTACGGTCG
GCTCGGTCTACATCAAGACGAAGGAGGCGCCGGCGCGCGAGATCCTGACCGACCTGGTCGAAATGACTAAGGGCGTGCAGTACCCGCTGCGCGGTCTGTT
CCTGCGCAACTACCTGTCCATCTGCGTCAAGGACAAGCTGCCGGACAAAGGGTCCGATTACGAGCGCGCCGGCGGCGGCACGACCGACGACTCGATCGCG
TTCCTGCTGCACAACCTGAGCGAGACGAACCAGCTCTGGATCCGCATGCAGTACCAGAAATCTGGCGTCGCTGCAGCCAAGAACAAGGCCGCACGCGAGA
AGGAGCGGCAGGATCTGCGTGTGCTGGTCGGCACGTCGTTGGTGCGGCTAAGCCAGCTGGAGGGGGTTTCTGTAAGCGTGTATTCGTCAAAGGTGTTGCC
GCGGCTGCTGGAGATCATTGTCGGATGCAAGGACGCCATTGCACAGCAGTACCTGATGGACTGCGTCATCCAAGTCTTTCCGGACGAGTTTCACTTGCAG
AACCTCGAGAAGATGCTCGCCGCCATGAGCGATCTCCACGTTCGCGTGGACATTGCGACCATCTTGTCGGCGCTTGTGGAGCGGTTGACTCGGTATCACG
AAGGGACTCGGCCTTCGAAGCGCGACACGAGCGGCGGCAGCACGGACAGCGCTGAGTTGAAGCAGCGAGAGTTTTTCAAGCTGCTTTTGGACTGCGTCAG
CAAGCTTTTGGTTGTGCCGACTCGCGGTTCCTCAATCAGCGGCGCTTCGTCGGACAAGAAAACTGAATCGAGCGCTGACCTGACGGAATCTCTGGGAACT
CCCGGCGAATCGACCTTGTCGTTCTTTGTGGCATTCGCCAAGTTCACACTGACCTGCTTCTCCTCAAGCACATCGCTGCTGCAGGAAGTTGTCAAGTGCT
TGCTGGCGTTTGTGAATGGACGGTCGTGGAGCGAGAAGGACATCCAGAATATGGTCGTGCCGCTGGTCAAGGAGTTTGTCTTGATGGTCTTCCAGCATCT
CGCACTGCAAGAGCTTACCCACGTGAACGACATCAAGGACGTGTTGCGGATATTGCCGTACAGCACTGCACGGAAAGGGGTTGCATTGGAGTGGATCGAG
ATGCTTTTGAAACGGAAGGAACATGTCGCGAACGTTGAGGAAATGGAGCTGCTGATGGAGCTGCTGTCTCCGATAATCCGGGACGATCCGTCCGAAACAC
CGCTGTCGATGGACTATTCAAGCGCGAGTCGAAAAGAGCTTGACGAGTTTGAGCGCGAACAATTGGTATTGTCGAAGGTGGTCCACCTGATCAAGTCGGA
CGATCTGAACTCGCAATATCGGATGCTTTCTGCTGCACGGCGTGCGTTCGGCCAGGGCGGTGTGTTTCGGATCCGGTTTACGCTCGTACCTCTAATTTAT
CGCTCATTGACGCTCGCAAGGGACCTGTCATCGACCACGCCGGATGCGGCGCTCGCAATATCAACTCGCGAAGTGCTCCAGTTTGTTCACGAAATGGTGA
CGGCGTTGGCGTCCAAGTTGGAGCAAATGTCCGTCACGTGCGTGAACCTCTTCCTGCAGTGCGCGCTGGTGGCTGACGGCTGCAACTTGGAAGCGATCGC
GTACGAATTCATCACGCAGGCGTTCATTGTATACGAAGACCAGATCACCAACTCGCGAGAGCAGGTCAAGGCTCTCGAGCTGATGGTGTCGAGCCTGCGC
GCGACGAACAACTTGTCGAACGCGAACTACGACGTGCTGTCTGCGAAAACAACGCAGTACTCCGCTCGTTTGCTCAAGAAGAGTGAGCAGGCTGGCATGG
TGATCAAGTGCGCTCACTTGTTCTGGGTGAGGTGGTTGCACTCGATGGTTCCATCTGCGCTGAAACTCTAACATGTTTGCTATTGTGGCTGAATGAAGCA
CCCGCGGCACCAGGACGGCAAACACGTGCTGGAATGCTTGCAGCGCGCTCTGCGCATCACTGACGGCATGAGCGGGTCAACGTCGAGCCAAGTGCCGTTG
TTCCTGGATATCCTAGAGGCGGTGAGTCAGCAATGCTTCGCGTTAACCCGAGTTGATGTTTCGTTCGCTGACAATTGTGCCATTTCCAGTACGTGTTCTT
TTACGAGTCGAAGAGCCCGGAAGTGACGCAGAACTATCTGAAGGGTCTTGTTGCGCTGGTGCAAGACCACTTGGACAATATGGAGCATGGACAGACGCGG
AACGAGAGCGAGGCTCGCTTTCGCGACATCGTGCGCTTCATTGAGACGAAAGGCCTCACGACGACAGCCGCTACAGCATAGTCATCGGTCGCAATCAATG
TACTTTGTTGATGCACGAGTTAGGATGGTGTTGTGTTGGCGCTTCTGAGTTCGTTCAAAGTCGCGTTATCCCTATTTGACATGGTTGGTGCCTCGAGGGG
GAGCGACGTCTTATCCGGTTGCGCAGACTTTCCAGTGGCCAGCAAAGTTTTGGCTTGGCCAACAGCGCGGACACTTGGCGAAGCTGCGCGCTTGACCCAC
ACCTGCGAGATGGAGTCAAGCGCGTCGAGCACAGAGTTTGGAGCATCATCGGAGCCGACGTGGAGCTGGTATCCGCAAGTCGCTTGGTTCTCCTTCGTGT
CGAGAATCAAGCGCAGCAGTTTCGTTCCGCGAGGATCCGCTACGAGTATGCGTTGGAGGTCGCTGGAAGATTGTGGTTTGAACAGATCGTGGTCGCCAAT
GAAAAGAACCGCTGCTGCAAACACGCCAGTCTGTTCAAACGCATTTGTGAGTCGCATTAGATCACAAACACTCGTGAAAGCAGGACTCACTGACCGGAAA
CATCTGCAGTCCAACACAGGGCACACTGTTGGTCGCTGAGGACTCGGGTATGGAGGAGTTCAGACTGAGGAACAACACGAAAGTGTGCGCTCGATCTGCG
TTCCCAAATCCCATCCTGCTGGTGTTGGAGCGTTTGAGCAGCGACGTATGGTACAAGAGTGGGAAACAGTCGTGGAGGGCGGTAACTGATTGCTCCAGTA
GACGAGCGAATGTGGAACTGGAGAGCATTTGGAGCCATCGATGCGGAATCTCAGAACCCGAGGCCGGTGCTGGAGTCGCGTACGCAATGTCGCCAGTTGC
AGCATTCAGAACGATACCTTGTAGGAGTTTGACCGGAGGTGATGGTTGGACGAGCGGTGATGTCGATGATGATATCCATTCTAGTGAAGACACTGCATCG
TGCGCAGTCCTCTCCATGGTTGCGGCGACGAACGTGTGTTGGAACGTCAGGAACTCGCTGCGGGTCTCATCCTCGCTTTGGAACCCGTCAAGCGCGAGGG
ACAGCGTGTACGCCTCCGCCATGGCCTCGGCGTCCGCGGTGTTTTCGGCCGCGATCCGTTCAATGTCGTCCCGGAATGTGTGCCCAATCTCGTGTAGAAC
AACCAGACTCTTGAGTCTTGCCAGTTGCAGCGGCGATCCAGAGCCGAAAGAAGACAACCCGGCGATTGGAGCTCTGGATGTACGTTGGCCAGCTACAAAC
AGGACGGCCACTGCGACTTGCATAGCTGCGTCGATGGAAACGACGGCTGTGATCCCGCCTTGCAGCTCGAGGTGACCAAAGTCAGACCCCTTGGAGAACT
GGATGAGCGACGCCAGAAGCATACTCAGCATCGGGTAGTGGAGCGGCAGCGGATCGCCGCAGCCATCGCGTTCCCACTTGATGATCGTCTTCCCTGCGGT
TGTAAGTACGACACACGCGGCTGCAGC