Description :
From Genome Similarity Track
Location :
Scaffold_22:350283- 354786
Sequence
4503 bases(100 bases per row)
CGTCTAGAGGCAAGCTGGGGTGCCGCTAAGGGCATTTTAAATTGGCACATGGCAATGGACGAATGCATAGACCACTTACTTTTCTTGCAACAAGCCGCGG
AAGATGGGTGCTGGACGAAAGTGAACCGCGTTGGTTGCCGTTACAACCTTCACTACGACGAGGAAATGAGCGTGTTGGCGAAGCTTGCTACCCGTCACGC
TTGTGATTTGGTAGAGGATGAATACAAGCTTAGTGGACAGCTAACATACGACACCTCCAACGACAAATTAAGGCCGTCGTTCGTAAGCTTGACCCGTGTA
GAGTCAAATGTCACGTATGCTGTCAGTGTGGAGAAAAATCAGTGCAGCTGCAGTTTTTATCGTACATTGCAAATTGCTGAAGAAGAAGACGATAATGACG
AAGCTGAAGATACTGTGCCAAATTTTACTGTGAAAGATGTCGAAGCTCCGTCTACTCGTGTCCTAAATCACAACGAAAAGTATCGCGCTGGGATTGCAGT
TTGCCAGAAAATAGCAGAAACTATCTCTGATAAAGGATCGCGGAGCTTCCACAAGTGGATAAACTACCTAACGAAAGTGGAATCGCTTGCCAGGCTCGAT
GGTGCTGTCCCTGACCTCTCAGAAACCACGATGACCCTGACCGTTGGTGAGCGAGTCATTAACTCTCCTCAAATTGGTGAGCAAGTCACCAACTCTCCTC
TTGTTAGTGAAGAAGTCACCAACTCTCCTGATGTTAGTGAAGAAGTCACCAGCTCTCCTGATGTTAGTGAAGAAATCACCAAATCAAGTGTGGTTGTCGC
AAATTGTGATGATATTGGCGAAATAATCGCTAATTCAGTGGATGCCGGTACGCCTGGTTCCAAAGTGATAGTCCCGCAAGTTAATGGCAATGGTGAATGT
GCATCCAGTTCGCTTGGGATTGGTGATATTGCCACGAACTCAGTCAGCGATACAACGCGTACAACGCGAAGACGGCTTGATATGGCTTCTGAGAATACTG
GTGCAGTTAAAACCCCGATCATTCTACTCAATCCAGCCAGCAACCCTGCAGGACGACCAAAGGAGAAGAAAGCAACAAAAAATGCCAAGGCGCGCAAAGA
GCTTCAAGAAACCAAGACCCTTTCGAAGCAGTTGACAACTGTTGGCGACATAACACTTACAACGCTTCGTGAACATGTTGACCAAAAAAAGTTGTCTCTC
GCCCAGTCTTTTCGGCTATTCGCCCGATGTTTGGAGGGGCCATATATAAACGGCCAAAGGCACGCTTGAAAAGACGTGGAGAAGAGCTGCAAGTTGAAAT
CAACATTCGGTATGTCATCCCGGAAGTTCTGGTGGACAAATCAGTAGCAGCAGCAAAAAATGCACTGTTTCGAGAACAGACTGCCAGCAAGAAGACACCC
ACACTAGGCGAAATTGGAGTGCATATTTTGGGCGTGGGGGTCTTTTCACTACAAGACGTGAATACTATGAAGGATTGGCATACTCTCTCGAAGAGAATCA
AAAGCACGCGAGACTTGATCAAGTGGGTTCAATCAAAGCCGGAAAGTGGTGTGCAACAGAGCATTCTCTCCACGCTGCCTACTTTGAATATGTATTCCGC
ATTCAAGTCTCGGATCGCAGAAACAATTGTTCAGTTTCAAGATCTAACTAGGTTTGCGGGTGAAAACTGGCTGTGCGACGGGTGTATATTTGTTGCGGCA
CTACACGCGGTCAAACAAGCACAACCGATTGGTAAAAACAGAGGTGGGGTTACTGAAGTATTGGTTGTGGACTCCGTTTTTCTCGGTTTTGAATTGGAGG
TCGATCGAAAAAGATTAATTGACATGGACAAGCACATACTAACAAAGGTGACAATGGACGCATCGTTTTTTTTCCCCGTAAACATTTCGGTGGACGTGCC
ACATTGGTGTGCCGCAATTGTCGACTTCCGAAGCTGCTCGATCTGGATCTATGATCCGAAACAAAAACTTGACTATATCGACGAAGTTGAAAGGATCATG
AAGAGTTACGTGGTCCCGCTGATCGATCCTGCGTTCAAGTTTAGGTTCAAATACTCGTCTTCATGGCTGCAGAAAGATGGATACAACTGCGGTGTTCTCA
TTGTAAAGTGGTTTGAAACCTACCTAAAGGTCGCAATGAACACGAAGCAACAGGAAGACTTGCGTGCACTGACACCTGAGCAAATACCAGAGAAGGATAT
TGAAGAGTGCAGGTACAAAATGTTCGAGACGATATGGCTCGATATTTTCGATAACTAAAAGGCATACAATACATGTAGCGCATACCGTCGTCATTATGGT
ATGGTTGTTGCATGTCGAGTGCCACATGCTGCTGCGCCGCCTCGCAGACGACACGGTCGTCGAGGCACTGACGGAAAGCAGGTCCCAGCAACGAATGCAG
CAATGCGATTTCACAGAGTCCGAAACTTGTGTGCCATACATAGGCTTTTAAATATTTTTCACAAATACTCTTCTCATACCGGCTCATACCGGTCTCTCGT
TCGTACGATAAATTCGGAAAACAAGCTTTTTTCTACCCAATAGTTGGTGAACGTAGGGAGAGCCTTTGAATAATCCTTTGGCAATACATGAAGTCTCTAA
CTTGAAGCTCGGTAAAATGCGATGCTAGAAAAAAAGAAGTTACTTTTTATTTTACATTTCAGTGTCCTTTTCACTTCGTCAATTTTAAAAATAAACAGAT
ACTGTTTTAATAAATCGAGGTCAATAAAAAGTACAAATCGATCAAGCTGGTAGAACCAGCCAAATCGATGGATCTACCATTTAGTCCACACCGATATCCA
GTAAATCGACCATTTTTGCCGTTTTGAAATGGTAATTCGATTACAGACTAAATAAATCGATGCCTGCCTCTTCCTATCTCATTTTTATGCATGGTTATAT
GCGCCGAACAGCTCGATCTACGCCGTAAAACGGAGGGACATTCTTTCTGCAAAGCACAATAACTCTTTTGTCAAGCATCGCATACCAGTCGGTAAACCTT
TGATTTTTTACCACATTAAATGTGGTCAGAATAAATAAAAACTAAGTTTGACCACATTTAATGTGATCATTAACTGTGGTCAAAATCAAAGTCTTACCGA
CTGGTAGTTAACTTCCGTAGTAGGTATCGACATGGAATCACGTGCTCATATTTTTTAAGTAAATTTTATTGAAAGGTCATTCATGTGGTAGAGTGGCAAG
TAACGATCATCTTAGACATAATATTTTTCTAAAGTTTTGTGAAAAACATAATTCTAGAAACGATAGCTCATTTTGAGTCCATTCGAAACGAAATGATTGT
TTGGTATTTAGCCTAAAAAGGCGTTATGCACACCATCGCGTCCGTACGTTACGGCATGTACTTTAAAAGTTATGGTCAATTAAAAAAAAAGCAAATACCT
CGGAGCTGGCTGGGCTTAGTCAAATTTATTTTTGTCTTTTACGAGCTAGAAACTAAGAAGAAGCAGATAGGGTTTCCGACCGCTCAACGGTCACTAGGAC
TGTTTGAAAAGGGTTTTACTGCGATTTGAGCTTGGTTCTCCAATGCGCTTGGACGATTATTTTTCGCTTGTCTGGACCAGTTTCGTTCTGTAACCACTTT
TCCGGTTTTAAATGCCGGCGCTCCTGTGTCGCTACTCGCGCCTAGAAATACATTTTGTCCATTTTCTCCAGATTGAGAAAAATGAAGACTCTACTTAAAA
AGGCTTATGTTACGTTTTAATGGACTCAAAAGCAATGTTTTAAGGGATATTAGAAATAACAGCCGAGCTATTAATAGCGAGTCCAGGACTCCGTAAAATT
GAATTATCAGGTTGATAGTTGTGAGAATCTGCAAGCAATTAATTACTGAATAATCGCGATCATTCTGACAGAGCCGGTGGCTAACGGTTTCGACAGCGTA
CACGTCCCAGAGCTCCCTTTTTATTGACAGCGACATCACCGCCTCTAGCCGCTCTGGTTCCATGCTCTTGCGTAGGTCTGTCAGAACCAACTTCGTAGCA
GAGAAAAACCGCTTGCAATCATTTGACGTTTGGAGGAACAAAACCGACGTTCATGTACCGTTGGCGCTAATTTGACTTGCGTCTCTTGAACGCGCTGCGA
GCAATCGAGGGTCGTTTCTCAGGCGTTTCGGCTTGACCGTGATCGTCATCAGCTAGCCTGAGCATCGCACACGCCGAACGCTCGGCAGCATTAAGTGCCT
CGTGGTGTTGCGTCTTGACGATGCCTGACTCCAGTGGCTGCTTGTTGATAATGGTAGCAGCCGTTCCCAAGCGGTCGTCCAGTTGCGGGTACTCCGCTCA
CATATAGTCGATCCGCCAGCGAACACCGGAGAGAGTCAGTGTCGACTTCTGCAAAGTTTGTGTGACGCCATTTAGCTTCTCTAAGTCGCCACACAGTTAA
GTTACTCACTCGCTCTCGCGCCGGCTTAAAAGGTAGCTCTCGAGGCCATAGTCAGCGACAGAGCCATGATCCGTTTTTAGTAAGAATGGCATTAGCTCCG
TGT