Description :
From Genome Similarity Track
Location :
Scaffold_2487:3501- 4970
Sequence
1469 bases(100 bases per row)
CTGGTGGAAATGCTGCTGGTGCATGGCACGCTCCATGATCAAATCGTACAGCGCAATGTCGTCGCGCTTGACATGCGGGTGCGTCAGCGACGCAAGCCGG
GCCACGTCAGTACGGAGCATCTCGGGCTCAAGGTGCTTCATCAACAGCTTGCAGCGGAGCTTCATGCGGATTCGACCTTGCTCATCTTGAGCAACGGTTC
CCCCAACCATCGCGGTGAGACCGTGGTCATCGACAATCTTGTCAAAGTCGATATAGAGCTTTGCAACACGAGCCTCGATGTCGGGCTCCTTTAGATCCAT
CTTGAGCGATGCAGCGAAAAGCTGCTCCACGTCTGGGACGTGGTTGTTCATCATCGACCCAACCTTGCGGGCGATATGCCAGCGCAGTTCGTCGTCCGTG
ACGTCAAAGACGTCCTTCTTCAGCACGTAGTGTGCAAGGTGGTCGAGCACACGAGGTTTAAAAGAGCTCTTCATGCTGGTCTTGACGGCGTCTGGGACTT
CCCCCGTCGCGGCGCAGCGCTCTCAATCCTCTCCTCATACTGGGCCCAATCACGGGCATACACCGTGACGGCCGGTTGGCTCCACTCTTCCAATCGGGGT
GCCCGGACGTACTCGTACACGGGCTGGGCAGCAACCATTTCAACGTCGCCATCAGCATCGGCGCGAGCTTGAGTCGACATGCTTGGTAGATGTTGATGCG
GCTTGGTGGTTGCGGGGGTCTTGTCGCGAAAGAATTCTTTGTGACGCGTTGAGCTCGTTAAAGCAAATTGGGAAGTGAGATTCAAAGGTTAGTGTGAAAA
GACGGCTAAGAGATCCTATGCTACGGCCCTCAGAGGGGCGTCCCCTACCAGCCCCTTGGTCCTCGGTCCTTCGTACTTGGTCCTTGGTCCTTGGTCCTTG
CTTGAGACTCGCCACTCGTGCGCCTCCAGCGGTAGAGCACTACAGTGCAGCAGTAGCGGTCACTCGCACGCAGTAGCAGCAGGTCAACATAGACACCCGG
GCACCGCTGGTGCCCGGCACAGCTTCATCTTCAAGGTGCCCAGCACACCGCCGAGCCTGGCATGCGGTGTGCCCGGCACACAATGATCACGCGCGGCCAC
TTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGCGGTGTCGGCACCGCTGGGTTCATACATCGCGGAGCAAGTCT
GACATAATCATGGTCGCCGCAGGCGCCACACTTCCCTCCAAGACTTGCACGCGTTNNNNNNNNNNCCAGTCAGTCGCCTACGTCATCACGGTTGTCCATC
TCCCAGCACATGCAATGACGGACCAATGACGGACACACAATGATCACGGCGGACATGGAAAGCGCATTG