Description :
From Genome Similarity Track
Location :
Scaffold_50:350014- 358089
Sequence
8075 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTATCTTATTTAGGTCACTTCGCTCTCTTTTGAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTT
TGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACT
ACCTGAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGG
ATGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGATGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGC
GGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAGCCT
TCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGT
GCTAAGAGTTGGGTGTACACTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTACTCCCGGCGA
ACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGACGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCT
AGTGGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGACCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGC
ACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAATACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTC
CCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAA
GCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCA
GGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCT
TCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGATTGACTCTGGG
GCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGCTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGC
GACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGA
TATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCG
CAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGG
GAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAA
CTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAA
GAGGAAGACGTCGGATACGCTTCCTGTGTGAGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTG
TGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCAC
GAGTGCCTCGGATGTTGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGAAGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCG
GATCCGAACTTCGTTCCGATCGACGTCGCTTTAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCG
ATAGCGAGACGGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTC
TTTCCTGGCCAACCTCAAGGCTGGAGAGATCGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAG
AACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATG
CGGACGTGGTGAATAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAG
GCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCG
ACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCC
CACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGA
CATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTG
GTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGG
TGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGT
TCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGA
AAGTGGTTGGGTTTGGCCAACTACTTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGC
GCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAATGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGT
CGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAA
GCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTG
TGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCGTCTTCGCGGAATATAACTT
CCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGAT
CTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCT
CGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAA
CGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCC
TTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCACCACTAC
AGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTT
CGTGTGCCAGTTCCCGTCACGGTTACGGGCGAACAAACCGCAAGGATGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGG
ACCGAGACCCGCGGTTCACTGCTGCGTTCTGGAAAATGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGG
CCAAACAGAGCGCGTCAATCGAGTGCTCAAGGACAGTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTT
GCGCTCAACAACGCGGTGCACGCGTGCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACTG
ACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTAT
GGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGAGGAAACTTA
AGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCCGTCGGCAGCAACAAGCTGAAGCACCGCTTCA
TCGGACCTTTTGCAGTCCTGACCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAA
GCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGC
AGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCT
GAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGG
CCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAG
CTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCA
GGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTT
GACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCC
ACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCACAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTC
CGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCA
GCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGT
GGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCATGTGGGACAGCTCTCGGGCATAACCCAGGGGTATCCCCAAACA
GGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCA
CGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTC
TAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGC
ACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCT
TCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGA
GGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGGCAAGCGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCT
TTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTT
CTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAA
CTCACGTTCTGCGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAG
GATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCT
TGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTC
TAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGG
TCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTACATAAAGTGTGACACTTCACACTTCAGGAGTATG
ACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTG
TATTAACCTCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCAGTGAAC
TGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA