Description :
From Genome Similarity Track
Location :
Scaffold_1666:350- 2998
Sequence
2648 bases(100 bases per row)
CTGCTCTTCGTGATCTCGATCGACGCCGTGTTCGCAATCATGGAGGACATGCGGCGCCACGCGTCCGACCGCGAGGCCAACTCGGCGAAGTGCCACATCG
TGCGCAACGGCCACATCGAGGACCACCTCTGGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGCGCCAGGCCATCCAGCCGACCATGAACGCGCTCGTGAATCCACAGGAGCTCGTGTTGCTGCGCGGCATCGTCAAGTTCGAGACGCCCAACCCGTAC
ATCAACAAGTTTGCTGGCAAGGTCGAGGTGACGGTGAGCGAGGGCTGCGGCATGGAGGTCATNNNNNNNNNNGGTCAAGAACGTGCTGCTGCGCGGCTGC
AACCTGCGCAACACAGACTGGGTCTTTGGCCTCGTGCTCAACACCGGGCCGGACACCAAGATCATGCAGAGCGCGAGCGCCGCGCCGTCCAAGTGGNNNN
NNNNNNNNNNNCTCTCGATGAACAAGATGATCGGCATCCTGTGCTTAGGACTTTTTGTGGCCTGNNNNNNNNNNGCCGCCACCTGCTACGTCACCTGGCA
GTACGACATTGTGCGAAATACCTGGTACATCAAGCTCAGCGACGACGTGCGCGCACAGNNNNNNNNNNGGAATCGTTCATTCAGATGATGTTTTACTACT
TTCTGCTGCTCTACCAGGTGATCCCGATCTCGCTGTACGTGTCCATGACGAGCGTCAAGTTCCTCCAGGCCAAGTTCATGGTCTGGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGATGGCGCTGAACGAGG
AGCTCGGCCAGATCTCGTACGTGTTCAGCGACAAGACCGGTACGCTCACTTGCAACATCATGGAGTTCCGCAAGTGCTCNNNNNNNNNNNNNNNNNNNNC
GCGCCAACAAACCGATCCCGCCGGAGCCAAAAATGGACGCGGGCATGAAGAAGATGCAGTACGTCAACTTTGTAGACCCGTCGTTCTTCAAGGCGATGAA
TGGAGGCACTGGTGCGGCCCAGCGCGACAATATCCACCAGTTCTTTGAGCACTTGGCCGTGTGCCACACGGTGATTCCGGAGAAATTGGAGACGGGCGAA
GTGCGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCGTGGGCTTCAATTTTGT
GAATCGAGGCGTGGGCAAAGCCACGATCGAGGTATTTGGCGAGCGCCAGGTGTTCGATATCCTCGATGTGCTCGAGTTCAACAGTACGCGCAAGCGCATG
TCGGTGGTCGTTCGGCGGCCCAATGGCGAGTTGTATCTGTACTCAAAGGGTGCCGACATGATGATCTACCAGCGACTGAAGGACGATCCGGCAATGGACC
AGCTCAAGAAGGTCACGCGCGATCACATGGAGAAGTACGCTGACGACGGCCTGCGCACACTGGCACTCGCGGTGAAGAAACTGGACGAGAAATGGTTCCA
GAAGTGGAAGATCAAGTTTGACGAAGCACAGGGCAACGTTGCCGAGCTCGACCGGCGAAAAGNNNNNNNNNNNNNNNNNNNNNNAGCCGAACGCGATTGA
CTCGCTCATGGAGGAGATCGAAGAAAATCTGGAGCTGATTGGCGCGACGGCGATCGAAGACNNNNNNNNNNCCAGGACGGCGTTCCAAAGTGCCTCGCGC
ATCTCACGGCTGCTGGCATCAAAGTGTGGATGCTCACGGGCGACAAGGAGGAGACGGCCATCAACATTGCCTACGCGTGTTCGCTCTTGGACAACTCGAT
CCAGCAAGTCATCGTCAACTGCACGACATGTCCAAATGAAGAGGCCATCATCGCGCGTCTCAACGCCGCCGGACGCGAGTACCGCGAGAAGACCAAGGCC
GACTCGAAGCTCGAGATCTCGCTGATCATCGACGGTGAAGCATTGGAGTGGGCGCTGAGTCCGCGCACGGCGCCGCATCTGCTGGAGTTTACGAAATTAT
GCCGCGCCGTGATTTGCAATCGCGTGTCGCCTGCGCAGAAAGCCGAGATGGTGCGGCTTGTGCGTGACAACATTCCAGTGGCGAGGACGCTGGCGATCGG
CGATGGCGCTAACGATGTCGCGATGATCCAGGCCGCGCACGTTGGCGTCGGCATCTCGGGCCAANNNNNNNNNNNNNNNNNNNNNNNNNTGCAGGCAGTC
AACTCGAGCGACTATGCGATCGCGCAATTCCGGTTCCTCGAGCGATTGCTGCTGGTGCACGGCCGCTGGAACTACATTCGTATCTCGAAGCTTGTTCTGT
ACATGTTTTACAAGAACATCACGCTCGTGCTGGCGCAGTACTGGTACGGCNNNNNNNNNNNNAAAATGTACTGGGAGCTCGGTGTGCAGGTGTACAACGT
CGCGTTCACGGGCATCCCGATCATCATGGTCGGCGTCATGGACAAGGA