Description :
From Genome Similarity Track
Location :
Scaffold_3363:350- 2562
Sequence
2212 bases(100 bases per row)
GTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCG
CCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTTAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGT
CCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACC
GGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTC
CGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGG
GCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCAT
ACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGC
GAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCATGTGGAACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGAT
AGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTTAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGTGCAGCCTCCAAGTT
GTCGGCGAACAACTGTTCATTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTATA
AAGAGGTCAGCCCCAGAGCTCTCCTCAAGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACAC
GCTGGGCAGCTTGGAACTCCTCCTGCCTGCTCGTGTCACGCCCCTGGCCGGGGTTCAAGATTTTCTTTTCAAAATCCCGCGGGTTTCCAGGATAGAAACC
TCCTCTTTCCCTCTCTTCCTCTCTTTCCCTCCCTCTCCCTCCTCTCTCCTCCGCGAGATATGTAAAAAATATCCGCCAAGAAAGAAAAAGATTCCCTCTC
TCTCCCGGATGGAATTAAGCATAGCTCTTGAGGCTGGGCTTCGTTGGAGCTACCCCAGACTCGGAACGAAGACTTTGCAGATCTCTCTCTCCCCCGGCTT
GGGAGCGCCCTTAGCTTGACGACCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCTT
TGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCCCGGACTCGGCATCGTCCTCACTGTCCGAGTTGAACTC
GCGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGATGAGAGCGACAGGCTGCGGCGCTTGCTTGCGCGCTTGTACACAGCCGCGTCACCCGAGGAA
CCGATCGCCTCGGAGGCCACCTGAGCAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGACTGGA
GGGTTCTTAGCACCGCTCTTTGGCAGTGCCCGCGAGACAGGTTAGCGTTGGAAAATGGGGAAACTTTAGAAGAAGAGGCCCACGGGTTTGTTTGCTGGAG
GGCTCTAACTGTGAAAGTGATCCTCCGCCGCGCTCGTGCGGCCAAGTCGATGGTTTACCACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCT
GATTGGTCGGTAAACCGAACCTAAGTGGGGGGGGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACAATCCACACTTCAG
GTGTATGACACGTCATACTCCGAGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATTTAATATAGGTAACTA
ACAGTTTGTATT