Description :
From Genome Similarity Track
Location :
Scaffold_1777:35- 2897
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1777-snap-gene-0.1Gene of unknown function

Sequence
2862 bases(100 bases per row)
TTTCTGCCTGCCTTCCCACTCACTGTTTCTTGTCCAAGAGGGGCGTCCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATTCAACTCTGTTAACGATGGCGCTCCGGGCGGGAGGCCTCGGAGCGAGAAATGCAGTGCCGTTCT
CTGATTGGCTGAAAAGGTGCTGCGAACACCCTTTCAGCCAATCAACGGCTGACACGTAGCGCCAGTCACAAGTGGGGACCGACGCGTACTTAGTCTAGTT
CAATCGCACCTAACACTAAGTACCTCCCAAATAGCCTAGAGAAACCTACTTAAAGTAACGGGACAAGAGCCCGTTACATCACCCCCTTCTCAAAATGCGC
GCAACATGCGTGCGTCACAGAATCTTGGAAAAGCGCTCGGAGAGACTCGAGAGAGAACAGCAGGTTTGTAGAACGTCCGACGCCACGGCGGCACGCAGCT
CCGAAGCCAGCAGAACGAAATGGACGAGCGCGCGCGCGACAGGGCCAACCGGCGCGAGCGTGGAAGCGGACGACCGCACCGGCGAAGACACGCGTGCGAC
GATGTCAGCCGACGACAGCCTGCTGGCAGCAGAGGACGAAGAGCGCGCGCGCGCCGTGTCGCGCGTGCGGGAGCGACAGCGAGCGGCGTCGACTCGGACA
ACACAATGAATGAAGCGGCAGCAGCTGCTGGAGTGGCGAGCACGATCAACCCGAGCCCGAGCAAGCGTCTCGCTGCACCCGCGAACATCCCGACGAGCGC
ACCGGTAAAGACGCCGGCGCGGGCGAACGCCAGTCACGACACCGGTCGCCGCGCGAACGTGGCAGGCGCCGCGATGAACGAGGTGTTGGTTCCGTGGGAG
CTGTACGACTTGGCTGGCGCCGAGGACCCGGCACCGGAGACGCTCATGCGCACATACTTCGTCCGCTTTCGCGAAGTGCGCCAGAAGCGTATGTACGGCG
TGGACGGGGTCGCGCTCCAGCGTTCGTGGTGTTCGTTCGTCTACAGATGGAACCAGGAACAACGTCACGGCGGCTTTCGCGAGTGGCTCGAGGGCGCCGA
GCTCAAGCTGCGGCGCCACGAGCTCGGGGCACTTCGTCTTGCTGTGTGCGACGTCGTGTGGGGATCTGGCAGTCCGTGCTTGGTCGACGCCATGGAAGGC
TGTCCGCGCTGTGCCGCGAACACTCAGCGTCTCACATACGCCGAGTGGCTCGAGGCAGTCGCAAATCACGCTTTTGATGACGAGGCGCTGCGCGATTTCG
GTCGGTACAAACGTTCACTCTCAGAGCAGACTCAAGCGCTTAATCGAGGTGGCGGGAACCGCCATGGAGGGCGCCGCGCTCGGGCGNNNNNNNNNNNNNN
NNNNNNNNNNNNNCACGATCGCATTCGCAATCGCCAGATCAACGAGCGCATGTGCCTCGCGACGGATGGCATCAGGAGCGCCGGCCGGAGGTCCAGCCTG
TCGACACTCGAGCGCAGAGTCGCTTGGAGGAGCGCGAGCGGGAGTATCTGCCGACGCACCGCGACGTGGCGGTTCATGCTCCGGCTCCAGAAGGCCAGCG
GCCGGCATGGCCGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCTCATGTCGACTCGCGTGGTCGAGAACGCGGCGCGGAAGATAATGAGCGAGCAC
GGCGGCCAGCGTATCGTGAAGCGGTGACTCGAGTGCCGACGCGGATGAACCAGAGATCGCCGTGGACGCCGGCGTAGCAACAGCATGGCGTGTGGCCGGT
GCAGCCGTGCGACGCGTGGCCGGAGCATCAGGCTCGTGACGCGCGCTCGACTCGAGCAGACTATCCTCGTACTGTGCGACCAGACCAGGGACTTCGAGGA
GCAGGCGCGCACGCGGCTCCCACGTGTCGTCACTCGGGAGATATCCGAGCCATCGAACGTGATACTGGCGCGCCGCTGGAATACCGCGGCGTGGGGCGCG
AGGCGGGTCTTGGTGACCAACGAGTCGCTCGACGATCCAGCGAAAGTTCCCCGCCGCGTCCACGAGTGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCCTGGTGGCGCTCGGGATGCAGGCCGATCGGTCGGAGCAGTGGGCGCAGGAAGCCGTGCTTGCGACGGAGGAGTA
CGATCGGCAGAACTACTCGCTTGAACGCCGCCTGGAGAGCGCTCTCCAGGCGCTCGAGGATCAGCGCGTGTGGCTTCGGCAGCTCGAGGTAGACCGGTAC
GGCGCGGCGCAGTCTGGGAGTCAGCCAGGACCACGCGCGGCGCGGCGCGCTCGACAGCGTCAGGGCGGATCGCTCTACGAGCCGGCTCGCCGTCGTCGTT
CGGGATCTCAGCGACGCGGTACTGCTTCAGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGGGTGCAAGCGCATTGTAGGTGGTA
GCTCTAGTGTGTACGCTTCGCCGTGGGTTTTAAGCACTTTAAATGGTCCAATAAAGCGCGGCGCAAGTTTGTTTGCTCCAAGATTGGTCACGGCGCTCGG
TTGGATGCCTTCTGTCGATAGAAGCACGCGGTCACCTGGCATGAACACGGCGGCGTTTCGGCGACCGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTCTCTTTCTGCCGATCGGTAGCAGCTTGCAGAGCGTCGCGAACAAAGCGCACGATGGCTTGGCGTTGAAGCAAGAACTCCGACACAGCGCGGG
CGTCACCCGCGCTCACTTCCTCGCGTGGTGCGAAGTTGGCGACCAAGGGCGCGGCCGGAAAG