Description :
From Genome Similarity Track
Location :
Scaffold_2389:35- 1853
Transcript NameFunction/comments
Phyta_totarag14443hypothetical protein

Sequence
1818 bases(100 bases per row)
GTAGCACTCGTAGTCAATCCTACACCTGAGTCTTACGACTGACCCTCTGTGTGAATGGACCATTTTGCGCACCTACCTCAGAACCAGCAGGACGCGCTTA
AAAAGCTGCTGTCCCTGCTTGGTCCTGAGGCCGTGGCGCATCTTGCGTCGCAAGGCCCGGGCGCGATTAACGCGCGCCTCGAGGCGTTCTCGAGTTATGA
GAatgctctgctggagcacattCAGCAGGAGGTGGCTGCGACGACAATGGCCACGCCAGTATCTACGGCGCCAAGGGAAGCTCCCAAACCGAAACCGCTC
ATGGTGAGCGTCAAGGTCTTCGAAGGGAAGGAAGGGGAGAATCTCCTAGTATGGACCCGTGAGGTCGAAATGGCTATGAATTCAGTCATGCTCCGAAcgg
agcagcaacgcgtggcgctggccaTATCTAAGCTCGGTGGAAGAGCACGAGAATGGGCACTCACGTGCGGAGCGGCTGTCGATACCGCTTTCCCAATCTG
GGATGAGCTGAAGAGTCAGCTGGTGGACTTCGTCCAAGAGTTACGTACGCTTATTGCTGGCATGTTTGCCGACCCTCTGCCTGAGGTAGTCACTGCGACA
GTGTTTATGGAAGGTCTCCGGACCGGGGTGGCCCGAACGGCAGTCTTCCGAGTCTACCCTTCTTTATTTGAAGAGGCCGTCGCGGTGGCATTGAATGCCG
agcacaacttcaagtcgGCCCGACTTGGTTGGAGTGCACCCCACTCAAACCCTTCGGGTGGTCCGGAACCCATGGATCTCAGCTacgctgaagacgaaga
agctgagcttCTAGCTGCCGAGCAGCGTATGAACATCCGGCGATGCTTCACTTGTGGCAGTACTCGCCACTTACGCATGGATGCCCCCTGCGCAAACAGC
GCCAGGCTCCACAGGATCGAAGCTCCGCTTCTTACCAGGGTTCAGATTCGTCCCGGGGAAACGGCGAATCCCAGTAGGTGCGGGGCGGCCTACTGGGGAA
GAAGTGAGTTCTGTTGCACCTCGCGGAGGTATAGGTCGACAGGGCTCCGCCCCGAAGAGATCCGGACTCTCTAATACGGACCGTGTATGCAAGCCGGGCT
TGCTGGTCGTCCAGGCGACCGTGAAGGGCTTTGAGAAGCCGTGGACAGTTCTGATTGACTCCGGGGCGTCGGGCAATTACGCTCGACGCTCCACGATGGA
GGGAAATCAACTGTATGTTGGAGCGCTGACAGCGCAAATGAGTGACAGCGTCACCGTTCGCCTGGCGACGGGGACTCGTGTCACGGTGCCTAAGGTCGCG
ATAGACCTGAGCGTGAAGTTACTGGTCTTCGATAGCATGGAGCGCTGTCTGGTCCTAGACCTGGATTCGAGGTACGATCTCATCCTTGGCATGGCATGGC
TCGAACGCCATGAACCATGGATCGACTGGAGGTCGAAAACATTAGGTGCTACGCACTTCTCTCCTGGTGGAGCATTGGCGAGTCATGAACCCACCTCTGC
TaggaagcagaagcgctaTTGGCGCGAGCACTGGGCCGAGTCGgccatggtgctggacatcGGTGTATTCGAGTTGATGGACAACGCTGTTGTCGGGGAT
GTATGTCCCGAGTACGGCTCGACAAGCTTGATGTCGAGGGGTCCCGAGCACGTCTCGCCTGACCAACGTGGAACGGCACGTACTCCGTTGGGTGGTGTGC
GTCGGCATGACGGACCGCTGAGTGTTCACACGAGCGCTATCGACAGTACCCCGGACCCGGTCCGGACGGTGCGCGTGCGGTGGGATTGCTTCCCCCGAAC
CAAGGGCGTTTATCGCCG