Description :
From Genome Similarity Track
Location :
scaffold_726:35- 1423
Transcript NameFunction/comments
Pl_102740hypothetical protein PHYSODRAFT_379323

Sequence
1388 bases(100 bases per row)
CAATGGTGCCATTTGCTACAAGATCTGTCCGACTGGCCAATACTGTCCGCGAGGAGAAACTAGTTGCACACCCCCACCGACGCCCTGTGTTTAACTACTC
TTTTCCAGCACGGCTGCGACCTCGGATCAACGGTAAATGCGCCTACTCGTCAATCGCCCCGACAGAGTTCACCGATATAAGGTACAAGACCTGCCCGACA
GGCCAGCACTGCCCACGTGGTGAGACTCATTGTCGTGCTCCAAGCGTGCTTCAACCCCGCTATTAGTCTCTTTCAGCACGGTGTTACCAGATTCAAGTGC
ATTAACTGCAAATGCGTCTACAAAATAACAGAATCAAACACCAGGGTCTCGATGACCGAGTCAACCAGCCTTCGCACGACCGTCAACAAGCAGCCTCAAC
GATACTATTTGTTATAAGGTCTGTCCGACCGGTCAGTACTGCCCACGCGGTGACATTGAGTGCCGTACGATCTGTGTCAATACGGCTACCAGTCTTTTCT
AGCATGGCTGTGCTCGCGGCTTCAAGTGTAGTTACAGCAAGTGTGTCTACAAGCAAAGAGACAGCAACAGCTAACCCAGCGAGCAAGTGCGCTCGAGAAG
ACAGCGAAAACTGTCAGCAACTGTCCAACCGTGTATTAGCCATACATGCCATTTTTCGTACCAGGTATACCATTACAACAGAAGAACTTCCACTAGTATA
ACTAGTGGAGTTCTAACTTGTCCGTTAGAAATATACTTACTTAAACTACCACAAGTGTTGATGATTCAATGATGTTCATGAAACGTCATCGAGTCCATGA
CACGGACAACGTGAAGCGGATAAGCTGCAAAATCAGATAATATGTATCAAAGAACCGATAGGGACGTGAAGTATAACAGCGTCGAACATAGTACACTGCT
ACAACAATTATAGCATATATACACGTTGCCGCAGCAGGGGTCCGCGCTGTCAGTGCAGCGAAACCATGGAACCAACACCGGAAGAGTGCATTTCCGGTGA
TGAGCCGTCACCGAATAGAATGTGCATTGGTCATCAACTTGGTGCGCCACACCTTGGTGAACCGAAGTTTATATGACTGTAGATCCATGTTTTGGTTAGC
TGACAGGTAACACTGTTCGTACAAGGTTCGTACAAACATGGACACTGTCGTACAGTACAGTGCTGGTCGCAGGACACTTTGACCACCAAAGTGAAAGCTG
GACTGGAATCAACTAGGAACGTGCCACGCCTCTTCAAAACTGGTTGCTGCACTGCTCATGAACAGATAAAACGGAGACGGACGACAAGCTGGACACAACC
AGCAAAGACGACCAAACTAGCGTTCAAGGTGAGATTTTCAACTCATACCCACAGCAAACAGTGCAAAGCCCCCACTGGAAAGTGCAAT