Description :
From Genome Similarity Track
Location :
Scaffold_9:34998- 39342
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004331Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
4344 bases(100 bases per row)
CGCTTCCTCCAAGCACAAGCGTGTGTGCCGTGTTAGAGGGACTGTTTGGAACAGCGTCCCATTACACCTGGTAGCACTTTGAGCGGTCCTTCCAACGACC
CAGTGAAGTGAAAGGATTGACGAAGCGGCTTTAAGCACTTCGCGCATTCCTGTCCAATACCTATTCTTAACCATGTCCGGGAGCATGGAAGGAGTAGATG
TGCCACTCGGTCCAGCAGTACCGCAAACTGTCGAGTTGGCGAATGAGTACTTCCCTCATTTGTATCTTCATGAGCGGCCGGCGCTGGAGCGGATGCGAGA
TGCCATCGGGGAGGCTGCTGTGATCAGCCTGCTTTGATCGGCATCTCCTGAAGACCAGAAGAACGCTGCGATCAGTTTCATGCACCACGAGATTGTCGAA
TCTCGAAAGCAGGTCGCAATCCCTGTTTCGTCCCTCAAGACGGTGCCTCTGAAGTTGAACGTGTCTCCGTATCGTGGCGGAGAAAACGAGCCTCTTTCGA
GATGGTTTGTCGAGTTGGATGCAGCAGTGTCTGCAAGACAACTCCGTGACCCTTCACAGCAAGTGTTGTTCGCGATGTCCAACCTTGCGGGTCGTGCGAA
GAGTTGGGGTTATGGTAAGCGTTTGGTCGATCCAAACTGCTTCTACAGCTACGACAACTTCAAGACCGAGCTGAAGAAGGCGTTTGAACCGCCGCAGAGT
GAGTTCCGCGCCCGTGCCGAGTTCTTGAAGCTTCGCCAAGGCCGTTTCGATCTGCACTCGTATGCTCAGCGAGCTCGCTACTTGGTCTCAAGCATCGTGG
ACGAGCCGATTGACGTCCCAACGCAAGTCGTGACGTTCATGACAGGTCTGAACGACGGTTCAATCCGGAACCAACTGTTCCGCGAGTACCCAAAGACCCT
GGAAGAAGCCGTCAGCCGTGCGATGCAAGAAGAGTTTAGCATCAAACAAGCCAAGTTCCAAAGTTTTCCATCAAGACCACCAAGACAATCGAACGTTGTT
CACGATGGTCCAGAGCCAATGGACATCTCGTACATTTCCACGCCTGGAAATGAGCGCCCTCACAACGATGGAAAGTGTTTCCGTTGTGGGAAGTCGAGCC
ACTTCGCTCGAAACTGCAAAGTGTATTTGCCTGATTGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGACCGTAATAATGGTCGTCGGTTCGATCG
TTCCCAAAGGTCAAAAAACGGGAACGACCAGTAGGGGCGGGGTCTCCTACTGGGCTCAAAAAGAGGACTGTGAATGTTGTGGAAACACAGGGCTCTGGCC
CCAATGTGCATGGTGCACATGCAGTTTCCACGAGTGAGAACAGTGTCAGCCAAACGTCAGGTTTGATCGTTCTCAAAGTTCATGTAGATGGTATTGCAAC
GCCTCTACGTGCTTTGGTTGGCACTGGTGCATCGAACAATTTTGTTCGTGCGCAAGTTGTGCATGGGTATGGTTTGCACCTACCCGATGCGAAGAATGAG
ATGGTTGTCCGGTTAGCGAATGGGACAACTGTGAAGATGCCAAAGCGAGTTGTTCACTTGGTGATTGAGTTTGAAGATTTCCGAGGCGAGGACGAGTTCA
TCCTTCTCGACCTCGATGACAAGTTTGACATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAACACGAAGATCTCCGT
TGACAAGTCGTGCATTGCTGGCTTGAGCTGCATGACAACGGATGAAGTGGTGTGGGTTTACACATCTGTGGAAGGAGTCCCAGATGGCCCTTGTGATATT
GCGATGTGCGATGGCCCCCCATGTTCACAAGTGGCACCCATTTTGAAGAAGACGAACGGAGGTGGAGCAGTCAGGCGCCATAAAAAGACTGTTTCTTTCG
CCAACAACGATGAAGAATTCCGTTGTAGCGACGAGGAGAAGACCAGGGATCAAGGTAGGGTCCTACCCCATCATGAGAACAAGAAGACCAGCAAGAGAAG
TATTTCGTCAAGTGTTGCAAGCGCAACGTGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGAAAGTGTCCAAGCAAGAGTCACTTCGAGCGAGTTT
GTGAACCTTCTGGTCTCGAGCGAAGATGGTGACGTCGATCTAATCCGTCGCGCGAAGATTGAAAACCCTCCAAGTTCAGTCGAAGAATTGATTTCCTTGC
CATCGATGAGCAAGAAGACACTGAAGCGTAGCCTAACGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTGACGATGCAGAGGACATCGGTGC
GGTATCAGCAATGGAAGCTGAAGTGCTCGATGGGAAGACACGGAAGGAAAGGTTCGAGGAGCAGTCGTGGGATGCTCTCAAGATGAACCCCGTGTATGCA
CTTGCCAGGGAATTTTAAGACATTTTTCCAGACAAGGTCCCGGACGAATTGCCATTTGATAGAGGCATTCGTCATGAGATTGACGTACTTCCTGGCACGA
AGTACTGCATCGCAAGACAGTAGCCGTTGCCAAAGGAACAAGTCGAGGCAATCAACGAGTTCTTTGCGCAACGTGCGAAGGCTGGCCATGTGCGAGAGAG
CAAGTCTCCGCATTGCAGTCCCACTTTTTGTGTGAAGAAGGCGACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACTATTCCT
GCTCAGACTCCGGTTCCACGCAAGGATATGATCCTTGATGGAATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAGGATGGATTCTATCAGATTC
GAATGCGCGAAGACGATGCCCCACTAACTGCAGTGAGTACCCCTAGTGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGACTGAAGAACGCTCCTGC
AGCTTTCAACAGAATAATCACGAACGTTCTTCGCCCTTTGCGAGCATTTGCATCGAGTTACTTTGACGATATCTTCGTTTATAGTAAGGCCACGGATGGG
AGATCTGACGTTGATGTTCATCTTGATCATCTTCGTCAAGTTTTCCAGGTCATGTGTGAAAACAAACTTTACGCAAACTTGAAGAAGTGCATGTTCTTCG
CCCCCGAGATTCCTGTTCTCGATTGTTTTGTGGGCAAGAATGGTGTTCGAGTCGATCCGGAGAAGGTCAAAGCTATTGACGATTGGCCTGTGCCTCAGAA
CGTCAAACAGCTACGCCAATGGTTGGGTCTGGCCAACTATTTGCACAAGTACACGCGCAATTATGCAGCGTTAGTGCAACCGCTCACGAAGCTCTTGAAG
AAGGACGTTGAGTGGAAGTGGTCGAAAGACCATCAAACGGCGTTCGAAGAAGTCAAGAGGAGTCTTCGTGAAGCTCCTGTGTTGGCTCTACCGGACCACG
ACAAGCCGTTCCACGTCGTCTGTGATGCGAGTGATTATGCCATCGGTTGCGCATTGATGCAACACGATGATGAGGGTCGAGAGCGAGCTGTTTCGTATCA
GTCACGACAACTCAGACCCGCAGAACGGAACTATCCAGTCCACGACAAGGAGCTACTGGCAATGAAGTATGCTCTTGTCAAGTCCCGTGTCTATCTGCTT
GGCGAGGAGCGCTTTGCGATCTACACAGATCATGCGTCGCTGCGGACAGCAGTAAAGACTCCTCACTTGTCGCAAAGAATGGTGAGATGGTTCTCCTTCT
TTGCTGAGTACAACTTTGTTGTACACTACAAGCCAGGCAAAACGAACATCTTAGCCGACGCATTATCAAGACGTCTGGATTACGATCCAAAGTCCAAGAG
TGAAAATATGGACGAAGAATGTCGACTTTGCGAAGATGTTCAAGCGGTCGCAGTTCAAGCTACGACGACAGTGCGAGAAGAGATTGTCGAAGGGTACAAG
TCTGACGAAACTTGTCAGGACTTGTTGAAGTACTTCAAAGACCCTTCTGACAAGGCACTGCAGAGCTTGCCTGCTCGAACAAGATCGCGAGTTCATCGCT
TCCAAGTACACAATGGGTTGTTGTACTATGCGGTTGAAGACGGGGATGCAGCAAGGCTTGTTGTTCCTAACGACGAGGGTTTGCGTCATTGTCTCTTGTA
TGAGTACCATGACAGCCCCTCAGGTGGCCATCTCGAACGTGAGAAAACGTTTCTCAGTCTTTCCCGGGATTATTACTGGCCACACATGTGCAAGTGGGTT
CGCAAGTATGTGAGGACTTGCGAGATCTGCCAACGTGTGAAGCCCTCTGGCTTCACGCAAGCCCCACTTCGTTCATTGGCTGTCCCATCGACAGTTGGAA
GTCTGTGAGTATGGATTTCATATTCGGACTTCCTCGTGACAACA