Description :
From Genome Similarity Track
Location :
contig_37:349946- 351656
Transcript NameFunction/comments
g7623.t1conserved hypothetical protein
g7624.t1hypothetical protein

Sequence
1710 bases(100 bases per row)
CCTTACGATCCACGACCTGCATAAGTTGGTACTCTGCATCCACGAAGTACGCGACGCTGGCACCGAAGCTCTTGCTCAGGAACGGATCGGAGGCCAGCGC
GTTGTGGTGCACACGCGACTCCCATTGCGCCTTGCGCATGCTCAGGCTCGCGTCCAGCGGCGTCAAAGCCGGTACTGGCAGAGCAATAGCGCGCTTATCG
ATCCCATCACTAGCCAGCACGTAGCTGTCGAAGTCCTTGTCGATCAGCGCGCGGTCCACCTCCATCGCCATCGTCAAATGGGAGTCTATCGAATCAACGT
TTACAGGTCTTGTGTAACCATATAGCCTCTGTAATATGCTGGAGGATACGCATAAAGTGTGACAGGAACAGTCGGCGGCGCTTGATGCACTTGTGGATTC
GAGCAGCGATGACGGAGCCGTCGGTTGTGGCAGTGCAGCACCAGATCCGCTCGAACGCGTCGGCAGCTGCAGGACTACTTCTCGGACCTGTACGCATGGG
AGAAGAGTATCGACAAGGAAGACTCGGCGCGGAAGCGAGCGGCGAGGACTACCAAGAGTTTGGATGCAACCCCACCGCCACGAACGGCGACAGTCGTTGG
TGTTGGCAATAACAGCGAATCGAGTGGAGAAGGAGATGCTACTGATGGGAAACAACCTGGTGCACATACCTATGACAAAGGATACAAGCGGTGGGAGAAA
TTCGATGTGGTAGGCTGCGTCTTTTGCTGTTGGTGACGATTGAATTGGCGACGCTGAGTTTCTGGGGATATGTGCAATGATTGTTGTGCAGGACGCAGCA
TTGAGAGAAGCGGATGGAGGGGGTTCTGCAGTGCCAATAGTTGAAGATTCACCAGCGTCGTCAGTCCCACGTCGGGTGGTTGTGATGGCCCAATCTGCTG
CGTCTTCGGCAACAACGAAAAGCCGGGAGGAGTTGGAGAAGGAAGAGGGCAATGCGCACTACAAGCGTGGTGACTATGTGGCTGCTGTCAAGAGCTACAC
GCGCTGTCTAGGCTACAACCCGCAGAACGCGGTGGTGCTGTCAAACCGAGCGATGGCGTACCTGAAGAATCGCGAGTTTGCTAACGCTGAAGACGACTGC
ACGCTGGCGTTGAAGGCCAACCCGACCCACGTCAAGTCGTTCTCACGTCGAGGTACTGCCCGCAACTCGTTAGGAAAGCACCGACTCGCGTTGCTTGATT
TTCACCGCGCTGCAATGTTGGATCCGAAGAGCCGTCAGATTCAGACGCAGCTTCAGTCGACGCGGGACCTCATTCGAACCGCTATCAAACGTTCTCCAAA
GCGCACGCAGTTTTCCATTGAAGTAGTTGGTGAGAGTTGTCTGGTCAAGCCAGAGGTAGGCAGTGAAGCGCTCGAGGACAAGGAAAACCTTGGTTTCGCA
CCAGCAGGTGAATCTATCCGCGGACTTTACTGACACGAAACACCAGCCTTCTCCACTCCAGGAATCAGGCTTGGCTTCGGCATCTCCACCATCTTCAACC
ACGACGTCTGTACAGACAACGCCTGAAAGCAAAAAGAAGAGGATGTTGGCCATTCTGCCCAAGCTCCCGAAGAAGGCACCGACCACTTCGTACGAATTCG
GTCGAGTATGGAAGACACTTGCCTTGCGTGGAGATGCCGAACACAAAATCCGTCTGCTCAGCTTACGCGCCGACTACCTACGCATGATCAACCCGACTAC
CCTCCGTTCG