Description :
From Genome Similarity Track
Location :
Scaffold_183:34992- 37658
Sequence
2666 bases(100 bases per row)
AGAAATAGTTAACCTCTCGGAGATGACGTGGGATCTGTTCCTGTCCGATCTAAAGGAAGGAAAGATCCACGAGATAGTCGCACCGGTTCCAAAGGAGAAC
TTTGTGGACTGTTGCTCTTCGTCCACAATGGACGAGAGTGTCTTGGAGATCGACAAGACAAAACAATTTGCTACATAAGGCTAGAAGGCTTTGAAAAGCA
GTCCGTTTTAAGAAGTTTTGTGGAAGCACTGTGGTCTCTTTCCTACAGAAGTGCCGAATCGCCTACCGGCCGATACAGTTTTTCGGCACGAGATTGACTT
GGAACCTGGCGCCGAGTATTGTCTGACCAGGCAGTGGCCATTGCCGAAGGAACAGGTCGAATACATCGACCAGTATTTCAACTACATCGACCAGTATTTC
GAATAGAGAGCCAAGGCAGGACGTGTACATGAGAGACACAGTGCTTCCACAGAACTTCTTAAAACGGACTGCGTTTCAAAGCCTTCCAGCCTTATGTAGC
AAATCGTTTTGTCTTGTCGATCTCCAAGACACTCTCGTCCATTGTGGACGAAGAGCAACAGTCCACAAAGTTCTCCTTTGGAACCAGAGCGAAGTTCATG
CTTACAGTAAGTTGAACACGGCAACCATTCCAGCGCAAATACCGATCCCGCGGAAAGATGTTCTATTGAACTTAATGGGGATGTCAACTGTCTTTTCCGC
ATTAAGTTTGAAGGATGGCTACTATCGCGTACTCGTGAATCAGATCTATGTAGCCAAGACGGCAGTTGGCACCCCAAGCGGTATGCTGTGGGAGTAGCCA
TTATTACCGCAAGGGTTAAGAAATGCATCAGCGACGTCTAATGGGTGGCCGCTCATGTGATGCGTCCGCATCGTGCCTACGCGTCTCATTGCTAAGACAA
TTTGCTCCTTCATAGTAGGGGCTAGGACGGGTTGAGTGAGATTGAATTGCACAAACGCCATTTGGACGTTGTGTTACAAACTCTGGAAGACGCCAAATTG
AACGTCAACTTGGCGAGAAGACCCAGATAAGGTAAAAGCTATTAAGGAATGTCCAATCCCACGACCTTGTGAAGGATCTGCGTCATTTCCTTGAGCTTGA
TAATTACATGCACAAATATAGCAAGAATTATGCAGAGCGAACCAACTAATGTCTGACCTCTTGAAAAAGGCGCAGAGAGGACTTGATCTGAAGCTTAAGT
AGATGATTTCACTTCAGTGAAGCAGTCACTTGTAGAGTCTCCGGTCTTGGCTTTGCCAGACGCGAATAAGCCCTATAGTGTTGTCTGCGGTGCGAGTAAT
CTCGCTATCAGCAGTTCACTTATGGAAAAGGATGAAGATGGTATTGGCCGTGTCATCTCGTATCAGTCCCGACTATTATAGGCCGCGGAGCTGAATTACC
CCGTGCACGACAAGGCGCTACTTTCTATAAATTATGCTCTTGTTAAGTTTCGAATGGACCATTTGGGCACCGAACCTTTTGTGGTTTACACGGATCACGC
ATCATTGCCGACCGCGATAAACACACCGCGTCTTTTTCTAGGATGTCCTGGTGGCTCACACTTTTCTCAGAAATTAATTTTCTAGTTGAATACAACCCGG
GGAAGTTGAATGTCCGGAAGCGTTATCGCGCAGACCAGACTTCGACGAACGACAACTTGAATCCGTATCTCGTGCCAAAGCACGAGTTGAGTCGTCAACA
CTGCCAGCCTGAAGTGTTCACCATGTAAAAAACACTCAGGCTTCTGATACAAAGGAGAGCTACATGCAGGACAAATATTGTCGTCTGCTTATGTATCACT
TAGATAGACGAAAACTTAATCTTTCGTCGCACCTCAAGCCAAAGATTACCGCTATAGTTATAGTGATGGCCTGTTATGGAATCAACTGTCACTATGTGAT
CCATTAAGAATTCATGTTCCCCATGACACAGACCTGAAACAGGAGATTTTATACGAGATCCATAATGCACCATCAAGTGGTCATCTGGGCTGTGACAAGA
CATTCTTACGAGTGTCCAATGAATTTGGTGGGCACACCTATATAGATGGGTAGCCAATGATATTCGATCATACGAAGTGAGTCAGCGTGTAAAGCCTGCA
CCTTCTACTAGTGCACCACTGAAGCCACTACCGATACCAACTGATTTCTGGAAGTCGGTCAGTTTGGACTTCATGTTTGGGATGCCGCCTGACCATAAAG
GCAGGACTGTTATCGTCGTCGTAGTTAACAGACTAAGCAAAATGTTGCATTTGGCATCTTTTAGCACCAAGATCTCAGACAAGGAGGCAGCTTTCTTGTT
CTGGATCACGTGTATAGATTACGTTGGATGCCCGAGTCCATAGTTTCGGACCAAGATACACGTTTTTTACGTCAGGATTTTGGTGCCATGCGTTTGAGCT
TCTTGGTTACAAGCTACACGTGTCTACCGCTGATTATATCCAAACCGATAGCCAGACCGAAAGGGTTAATCGTGTTGTGGACGATGTATTTTGCACGATC
GCAACTCCCAAGGAATGGAGAGAACATTAGCCATTCGCGGATTTTGCTGTCAACAACAGTGTTCACGCCAGTACGGGTGAAACACCACTTTATGCTAAAG
GACTGCGGCATCCTCGGACGCCAGTCTCGTTTGTGCGCAGCCTGAGTCTTTGTGGGGGAGGGCCCC