Description :
From Genome Similarity Track
Location :
Scaffold_11:3498436- 3502083
Sequence
3647 bases(100 bases per row)
CTTCAGCGGCTTCGCCCGCTTCTGCTCCGTCCGCAGTTTCTCCGCCGCCTGCGCTGAACACCGCGCCGTTATCATCTCTGGACGATGCTTCGGTGGCGTC
AGACGTGTCTGGCGTGTCACTTTAAACCGCTTGAAGGAACTGCATTGTGGTCCGCTCTTCGGCAGCTCCGATGAAGAAGAAGACGAGGGCAGCTCGTACG
GTCCGCACGCGGCGCGTCCACCATCCTCCACTCCCTCAGTGAGCGGCCTATTTGATGGTGACAGCGATGAGGAGACTGTACCTGCTGGTGCCCTTAATCG
CTTGAAGCGCAGCGTCGACTCTGGTGACTGGCATCCGTATGCTTTACCGTCAGCTCCGGCGAAGCACCCCGCCAATGGTCGTGTCAATCACTACGACCCG
GCGGCACCATGGGATTACTCGGTTCCAGTCAATATTGAGCAGCTGCACGACGCTCGCGGTGAATCTCCGCATCGCTGCTTCCTGGTGGAATGGCAGATTA
CCCCGCTTCAGTTGAGCTGGGTATGGGAAGAGCAACTCGACCAACGCTTCGCTCGGCGCATGGATCAAGTGATGCAATGGCGTGACGATCTGTGTCCAGG
TGCCCTCGCCTATTATTACAAGAAGCATTTTGCGCGCCGTGATCAGGCTTTTCCTGCTGGAGGATGCTTCATGGACGCGTTCCGCGCGGCGCTTTATCAC
CTTGGTGATACTGGTCTTGCATCCACGGCCACTGAGCTATGGGTGGATTTCGTGCGTGATCACCCAAGCACTGTCGACGGTGTTTCTCGTGCGGAAGCTA
CGGAATTCTTTCGCGTTCTTCAGCGCAACGATTTTCCGTTGGATTACGATCTTCTCTTCCAGCGTCCACTTGATGCTTCGTACACGAATGTGGAGCGGTT
CCAGACGTTTGTCCAAACACTGCGTGAAGGAGTGTATCTCACGAGTATTGGTGATGGCCTCGTCGGACACTGCGTTACTGTTCTCGCGAAGGGTCCAGAC
ACTGCTGTTTCCGTACTGGATGGCGTTGAACTGCCGGTGACCCCGAAACCTTTGCCCAACTTGGCGTATCTCGACAAGGTCAAACGGATGGGATTGATGA
AGCGGAATCTAGGGTATCGCTGCCGCCGCGGGAAACGAAAGTCCAGGCCAAATCGAAAGAAAGCTCGCCGCGAGAAGAAGCAGCAGAAGTTGTAGGGAAT
GTAATGTGGGAATACATGTAGGCTCTCGGGTCCCCTTTACTCCTGCCTTTGTCATTCATCTTCTTCGCCGTTTCCTTCTTCTGGATGCTTCGAAGTCTCG
AATGAGATCCGGGACCTGTGAGAGATTCTCGACCGGCTCCCAAGTGGGTTTCTCCTCACCCAACCACTCCACAAGAAATTGGGTTCGTTGCTTGTGAGTT
CGTTTACCGCGAAGCCTTTGGATGAGTTGTCCAACTGTACCATCGGCTAGAACGACATCATGGGGCCTTGACATCCGAGTGGCGTCCGTGTAAGGCTTCA
AAGATCCGGTGTTGAAGACTGGATGAAGTTTGTTTCCGGCTTGGACGTTGAGCTCGTAAGCGTGATTATGGATCCTCTTCACCACCGTATAGGGACCTAT
CCACTTTGGACCAAGATTGCTTGAGTTGGGTAACCCTGTATGTTTCCGATCTAAGTGTTTCGTACTCAAGTACACTCGGTCGCCAACTTCGAAGACTTGC
TCCACCCGGTTTCGGTCGTACACATCGCGCATTCGCTCTAGCGCTTCCGTCAGTGCTTCCTGACACTGCCGAAGAAGAGCTGCTTGGCGCTCGTTGAACT
CAGCACCACGACGACTTGTGGGGACCTTGCCACGATTCTCCGCCGCAAGTCGAAGCGGGTTTAGTGGGACGTATCCGAAACCAGCTTCGAAAGGCGCCAT
CTTGATACTACTGTTCACGGTTGAATTCACTGCGAACTTAGCATTGGCAAGATGGATATCCCAGTCGTCTTGAACAGGGCCCACGAAGCACCGCAAATAT
TCCTCAAGTGTCCTGTTTATCCGCTCCGTCTGGCCGTCTCCTTGAGCTCGATGCGCTACTGTCATCTTGAGCGTTGTTCTGATTGATTTGAAGACGTGCT
GCCAAAACGTCGAAACGAACTTCCTGTCTCTGTTGGACACGATGCTTGCTGGCATTCCATGAAGTTTCCAGATATGGTCGATGAAGAGCCAGGCAACGCC
TTCGGCGTCTACCTTCTTCGTAGTCGGTACAAAGTGACATCGCTTTGTCAGTCGGTCGACGACGACCCAGATGGAATCTACTTCTCGTTTGGTTCGTGGC
AAGTCAGTGATGAAGTCCATCGAAATCGATCTCCACCGTTATTCCCGGTGGCTTCGTTAGCCTCGGTTTGTTCCGTCTACAAGGCTCACAGTCGGCAATG
TACGATTGGATTGACTTCAACATCTTGGTCTAGTACCACCTCCTAGCCAGTGTCAGGTACGTCCGCTCCGATCCCGGATGTCCCCCGTAGTTGGAGTCGT
GACACTCACTGATGACCACCTGCCTCAACTTCACATCGTTGGGCACTACGATACGTGGACTATCGTCGAATGGAGTCTGGTACCACAGCAAACCGTTGTC
TTCCGAATAGCAGCGATACTGTTTCTTCTGTTGTCGCCTGGCTTTCGCCTGCTGGCTATCTGCACGCCGCTGGATTGCTGTAAAAATCGCTTTTGCTTCT
CGATCTCTCTTGTACGCCTTTTTAATCTTGGCTATCAACTCGCTGTCAGTGGTCACCTAGCTGACTGCTAAACTGAAGGACGCATCATTGAAGCTGGTCA
CACTCAAGTCATGAAAGTACTTCGTCTCCGGTTGCAAATCTGGTCTTCGGCTAAGTGCGTCTGCGATTCTGTTCTTCGCACCCGGAAGGTATGAGAACGT
TGGCGGATACTCCGCGAGGATATCGTACCAGCGCGCGAGACGACGGTTCGCCATCTTTTGAGTAAAGAGACCTTCAAGACTCTTGTGATCCGTTTCCACG
ATTGGTGGCTTGTCCAAGCAGTAAATACGGAAAGCTGCCAGCGCGTGAGCAATTGCCAGAAGTTCTTGCTGCTGCGTCGGGTAATTGAGCTCCGCAGATT
TCATCTTCCTACTGGTGTAAGCAATGGGTAGCTCAACACCATCGACAACCTGGAACAGGACTCCCCCCCACTGCAAACTTGCTAGCATCCGTACGCAAAT
GCATAGGCTGATTGAAATCGGGCAAGTGCAACACTGGTGGATTGCACAGCCGTTTCTTCAGCTCCTTGAAGTTGTTCGACTGCTCTTCGTCGAAACGAAT
CTTCGCATTGCGCTTGGACTTCTTCTTGAGCAAAGTAAACATACTTGCTGTCAGCTTCGCGTAGTCTGGGCAGAATTGTTGGACGTATCCAGTTAAGCCG
AGGAAGCTGTGAAGCTCCTCTTGCGTTCTTGGAATTGGCCAGTTCTTGATGGTCTGCACCTTATCTGGATCCATCCGCACGCCGTTTCTCCCAACAAAAT
CTCCAAGGCATGGAATTTCGTCGGCACAGAAGACGCACTTGGACAGCTTCACGTATAACTTGTTGTCGCGCAAGATGTCCAATGTTTTGCGGAGAGCCTC
CAAGTGGTCTTCAATCTTCTGTGTCTTCGCAAAGATGTAGATATCGT