Description :
From Genome Similarity Track
Location :
contig_29:349806- 352557
Transcript NameFunction/comments
g6819.t1XP_002901954.1 conserved hypothetical protein [Phytophthora infestans T30-4
g6820.t1KUF81784.1 Phosphoenolpyruvate carboxykinase [Phytophthora nicotianae

Sequence
2751 bases(100 bases per row)
AAGTTGCAATTGAGGAAGGTGCCAACGTTGTGCCTCCCACATTGTTGTCACCAACGCTTATTAACGGCTAGGACATGGAACTTACACGGCATATTCACGA
TCTGTGACTCGATTCAACTGATAGCTTTCAAGCTGAGCCATTTCGTTCAACAATCGAGCAATGTGCATATCCACCTCACCCTTCAAGTTCAGTGGTAAGA
CTCGACATAGAAAAGTGCTGGGGGTGTGCCAGAGATGAAATCGTAAAATCCTGTACGACTTTACTATGGAAAGCTACGTGTGTACTTAAGCCATCCCTCG
GGTCGACTTCTATTGGCGACTCGATGGCCTCAAGGAGTTACTTGGCCGTGGGTCTGTTAGACGAGTAGTTCTGCAAACACTGTGTTTTTACTCTTTCCAG
TTCAGCTGGAAGATCTTAGATAGGTGATGTCTTCAAAAGGAAGCCCACGCTCCAAATGTCAGCCTCCACTGTGTAGGACAATGATAATAATATCTCGGGA
GCATGCGATTCCGCCTTCAAAGGATCTACTTTTGCAGCCGGCGACACTGCTCCATCATCGAAGTCAATAAGAAACCACTGCCGCCTTCGAGGTACCTCAG
CACACTGTCCCTCTATGCATCAGATTGATTGCATGCAGTGCCACCAGCGCCGTCAGGAGCTAGCGGACATTTTTAGGCGGGGGAAGTCGACCAACGGATA
CCAGCGTCAGGCTTCCTTAGCTTCACAACGTTCGGGACTGAATGTCTCTTTCATTCGCTCATGCAGCATTTTCAAATTACTAATTATGCCGTCGCTGGGC
ATGCTCGAGGGATACGTCTTCACCACACAGTCATCTCCACACCATTGACTCTTTTGACAGTCCTGAACTCGTGTAACCCAGCGGTCGGAAAAGAGTCGAA
AGGTTGAGCATGGCGAGAAAGAACGAAAGCCGGCCATTGAGATCACCAAATCGTACATTTCAATGATTTCCACTTTTGCACCACGCTCCGTCATCTCGTC
TTTCCGAATAGCTTACCAAGCACACTTGCAGTCCCACCGCAGCGTAGCCAAACACGTACGGCGCAGCGTCATATCTCCATGTTAATTTCTCACGCAATTC
TTTAAGCGGCACTTCCAACTTGCCTTGCTTCTTCCCGTAAAACACGCACCATTGCTATTCTTGCAGTAGAAGCAGACATCTGGAAAACGAATTCGTGCTG
CGACGAAAGTTTCCGTTTGGCACACGCCTCAGGAGTACCGAAATGATGGGGTCCCACAAGTGATGATATAGTTCTTCGATTTTATCCTCGGCGCCAGACC
TAGGGGGGTCAACAACGGAGCCCACGAGAGTCGCAGTTCGGTACGAAAGTTTTTCACGCGGTTCGAGGCTTGTTTCGTGATGCTCTGCTCTGGTCTCTTT
TCACAGTACCTATCTAGCAAAGCTAGCACCTTATGCAACTATTTCGCTGCGCATTGGCTTTGCTGCGGATACAGATCCGCCAGCCAGTTTTAACATTACC
GATGCTGGAGAGAACAGTGATCTTCGACAGTGCCATGCCTTGCCTTCCTACCTTTTTCACCAAAAACCACCCATACTTGTCAAGAATAACAAACATGCTT
TTGCGCGGTTGTGGGCCTCCTTGTTCCCGAGGAAATCCTCGAAGGGCTTGATAGCCATACCAACAACAGCTCTATTTTTTGTTTGCCGTGGGAGAATAAT
GTGGTTGCCTGCGTTGCCGCTCTTCGCTGCCTTGGTGACTCGTCGTCCCGTGTGCTCATTCGTGGAAAAACCAACCAATCGCCACCTGAATACTCGCTCG
CTTCAACTTGCCAGAAGGCTCCCGAGGCTCGCCTTTGAAGGTACGACGACAAGGACGTACCAGAACAAGTGTCGTCTAGTAGACCCTAGCAACTATTGCC
CTTTGCTACTGCAGTTGCTTTTTCTTTATATTTATTCGAGTTCGATGGAGAGTACATAGCTAGCTGCACCCCTATAGGAGGCGCAACTACGGGAAAAACA
CCTACACATTGGGTCCGTACACTGACAGGTCGTTGCCCGGCAGGATGAACTGCTTGAAGTTCTCCTTGAACGACTTGGCCAGCTTGAGCGCCGTCGCGTC
GAACGCGGCCTTGTCGGTCCACGAGTCCTTCGGGTTCAGGATCTCCGACGGCACGCCCTCCACCGTCGTCGGGATCTCGAAGCCGAACAGCGGGTCCTTG
ACGAACGTCGCCTGGTTGATGCTGCCGTCCAGCACCGCGTCCACACACTTGCGCGTGTACGGCAGCTTCATGCGCTTGCCCACGCCGTACACGCCGCCCG
TCAGCCGTGTTGATCAGGTACACGTGCGTGTTGTGCTCCTGTAGCTTCTTCTTCAGCAGGTCGGCGTACTTGGTCGGGTGCAGCGTCATGAACGCCGCGC
CGAAGCACGTCGAGAACGTGGCCTGCGGCTCCGTGATGCCGCGCTCCGTGCCCGCCACCTTGGCCGTGTAGCCCGACAGGAAGTGATACTGCGCCTGGCC
CGCAGACAGCTTCGACACGGGAGGCAGCACGCCGTACGCGTCGCACGTGAGGAAGATGACGGCGTTCGGGTGGTTGCCGCGCGAGTTCGGCTGGTGGTGC
GGGATGTGGTAGATCGGGTACGACACGCGCCCGTTCTCCGTCTTGCTCGAGTTGAAGTAGTCGGGCTCGTTGTTGGCGTCGATCCAGACGTTCTCCAGCA
TGGCGTTCGGCCGGATGGCATTGTAGATGTCCGGCTCGTTCTCCTTGCTCA