Description :
From Genome Similarity Track
Location :
Scaffold_16:349797- 379776
Transcript NameFunction/comments
Phyra_76160secreted endo-beta-1,6-galactanase
Phyra_76161aminoglycoside phosphotransferase
Phyra_76162Hypothetical protein
Phyra_76163SWIB complex BAF60b domain-containing protein
Phyra_7139560S ribosomal protein L172 putative
Phyra_42429PREDICTED: similar to G/T mismatch binding protein p
Phyra_94404sorting and assembly machinery component 50 putativ
Phyra_76166PREDICTED: protein RRNAD1-like
Phyra_76167sorting and assembly machinery component 50 putativ
Phyra_76168RNA polymeraseassociated protein CTR9 putative
Phyra_71396ribonucleoside-diphosphate reductase small chain
Phyra_76170RNA polymeraseassociated protein CTR9 putative
Phyra_76171peptidyl-prolyl cis-trans isomerase E, putative

Sequence
29979 bases(100 bases per row)
CTATCAACAGATGACACGAATACCGTCGTGGCTTTTGACGCCGCGTCGAAGCTTCTTGTGGTCGTGACGGTGAACTCGGGCGACTCGGCATCTGCGGTCA
CTTTCGACTTGTCCAGCTTCACAACTGTGGGAGGTCCGATCACTGCCTGGACGACGGAGACGAGCGGCACGGGCGCGCTGCACGAGTCTTCGAAGGTGGT
TTTGTCAGGCACGTCATTCAGTGCGTCGATCCCTGCTGCGTCGGTCATGACGTTCGAGGTACAGGGCGTCGCAGCGTAGTTTCCCTTTTCAAGCCACCGC
AAATAAACATCATTTTCGACTGCCCACGATTTGCCCAGGAAAAATAGGCATGAACCATGCAGCCAGGGTCTGGCGACCGCCAATACAAGTTGAAGTTGCT
CTATCTTCATGCGGACTTGCAGCGCCTTGGTCTTCGTGCTTCATATAAGGTTCGGCGTGAGTTCTCATGTAGGCAGCTTGCAAGTTGTTGTTCTCATTGT
GTAGGCTTGCAGGTTGAAGGCCCCCGCACATAGGGCGTGTTCAGCCAATCAGATCTTCCCTTGAAACCAACGAAGCCAACACAAAGTCAGTGACTGGGGA
ACCCGAGGAGCTACGAAAATGGTGGACACGTCGGAGGTCCCGGCGCGTCCGGGTCAGATAACGACCGATTTCCTGCAGCAGATTCTGCGGCCTTCGTATC
CTTCGCAGCGCGTGGTCGACTTCCAGTGGACCCCCATGAACATTGGCGTGATCGCGGAGGTGGCGATCATCACAGTGGAGTTTGAGCGCGACGACGGCAG
TGGCGAGGCCAAGAGAACGCAGCACAAGTTCGTGGGCAAGTTTCTGCGCCCGGAATTCCCGTTCGAGTCGATGTTCGCGGTGGAGTCCAAGTTCTACAAC
GAGTTCACGACGAAGGCAGGCGACACAGCCATGAGGAACTCGGCGGCAACTGTGGGGTTTCCGTTCGCTATCCCGACTGTAGTCTTCACATCCAACGTGC
TGATCGTTCTGGAGTTTATCGATTCGACGAAGACCTTCACTTGCGTGGACGGAAGTCCACCCCAGCACATTCCGAAGCTGGTGACCAAACTCGCGCAGAT
GCACGCGCGCTTCTGGAACCACGACTGCGATGGTCTCGCCGTTCCAGCGGGAATTGGCAGTCAGCTTACTGGTGAAGAGAAGCGCCTGCAATTCCCTGGC
TGCTGGGCTGGTTACTTGGACGACGTGCCACTGGAAGCCAGTGACAAGGCGCAATTGACAGCGTTATGCCAGCAACTGAGCGAGAAGCCTGATAAGCTTA
AAGTGGTGCACGACAAGGTGGACGATGGCCCGTCTTCGTTGATCCACGGTGACTTTCACATCGCAAACATGCTGCTATCGACGGATCCTGCAGATGAAGT
AACATGGCTCCTGGATTGGGCAACCTGTGGTAAGGGCAATCCACTGCGAGATCTTGCCTTTTTCTTTATCGTCAGTGTCCAAGCAGCGCACCGCCGAGAA
CAAGAGGAACAGTGCTTGGAGATGTACCGCAATACATTAACAACAGAGCTGGAAGCTGCACAACTGCCGCTGGATGAACTGCATCGGCAGTATAAGATGT
GCGTGTTGAACCAGTTCGTGATCCTGGTCGTGTACGACAGCCTCAGCAAAAGTCTCGCGGCGAACGCCAAGACCGAAAAGATGCGTGTGGAGCTGGATGC
ACATTTTCGAGAGGTGAATCGCCGCGCGTGCTTGAGCGTCCTGGACAACGTCGTCGAGAAGGACCTCCAGCTTCTGCAATGAAGGCCTTGCCTGAAAAAT
CAGCTGCTGTACGTGTAACTTCGATGGGTTTATACAATCGGAATCGGCGACTTGCTTGCTCCCAGTCAATTAAGGGCGTGTCTTCTGGATCGGCTCGTTG
CACAGCTGTTGTCGATACAGATTACGAGGCCGCTCGCATACGAAAGTAGTGTCGGTCGGCTACCGACTCGGCAGGCATGGGCGGAGTCAAAGGGATCAGT
TGTATTTTTACTCACAGCTATTGATACCGACCGGAACGGCACAGTCATCGCTCATGAAACCCTATCATTTCATATGTGTTTCTTATTAATTGGGTGATAT
ATACCTGTAATAATGAATATACCCTCATGTATAAGTTTATTTATTTGGATGATAAAACGAAGCGCTTACAGTACTCATTGTGCAGCCTGCTGTGCCCGCC
CGTCTCGTCCTGTGTGGCATAAAACGAAGAACCGAGAGGGGAGCAGGTGCACATCTCGGGCGCGAAGAAGAGCGGACATGGCGCGCTCGATCCCCAAGCC
CAACCCGATCCTGGACACCCTGCTGGTGAGTCTGCTCGTGTGCGAGCTGGTCGTCATCGTGCACACACTGTGGGATGACAAGCAGATGCTCTACATCCTC
GTGGCCATGGTCTTCGTGGTGGCGCTGGCCGTCAAGGCCACAAAAACCTCGTTCGCCATCGGGGGCGGATGGTTTTCGCGCACGTTCTTGCAGCACCTCG
GGGACCCGCTCAAGAAGGCAGTGACTATGAAAAAGTGGTGCGACCAGTCGTGGCAGCTCGCCATCCACGTGTCCATGACGATCTTCGAGCTTTATGTGCT
GCGCGATGAAACCTGGTGGCAAGACACGACGACTTGTAAGGAATGGGCAACCTGAAAACTGTGTGGTGGGAGGACAAGATATCTTACTGTGTCTATTATG
TTTTCGTGTGGTGAATGACACTGCAGTGTGGAACCAGGGAACGGACACGGGCGTGTTCCCGACGCAGAAGTTTAGCACCAAGCTGCTTTACATCACGCAA
CTGGTGAGGGAGTGGCGTGCTTGTGTTACTGCGGACTTATTGGAAGCTGGTTAACGTTGTTTTGTACTTCGTAGGCGATCTGGATTTTCACTGCGTTCTC
GTGCAAGTTCCTAGAGGAGATCCGCAAGGACTACTTAGTGATGATGACTCACCATGTCGTCACAATTGCGCTGGTCACGTGGTCGTACGCTGTTGGCTTT
TTGCCTGTGGGTGTAGTCGTACTCCTTCTGCATGACATGACTGACATCCCTCTCGACATGCTCAAAATGGCCAACTACCTCAAGATGGAAGGCGTCCCGG
GTCTGTTCACGAGCGAAATCCTGTTCGTCATCACGATCGTGCTCTGGTTCTACTACCGCATCTACCAGTACCCGGTCAAGCTGCTCTACACGACGATTGT
GGAGAACCGCGAGGCCAGCATGACAATGGCCAACGCACATGACTTCACGCAACTGTTCCCGTACCCAGGCCCTCCGTCGTGGCTGCTCTTCAACGTGCTG
CTCACGACGCTGTACTGCCTACACATTTGGTGGGGCCTGCTGCTTGTGCGGGTGCTCGTTGGCGTGGTAACCAAGGGTACCCACGACACGGCCAAGGAGG
AGTACGAAGGCACATCTTCCGACTCGGACAACGAGAACAAAGACGACTAGAAAGCAACTGCATTGTTGGCGTGAAAGGACTAGAATGTGAAAGAAGACAG
CAATTTGACCAGAAGAGTAAGAAAATCGTCCTTCTTCAACTTGACCTTTACAACATCATAACGTATGCTATTATACAGGCCAATATTTGGCGCGAGCATT
TTGACAACCAGTGGGATAAGAAGGTCGCCAGCAACATGATGGAAGCGTTGGGCGATGCACCGCCGGTGTCGGTGCAGTCGCTGGTCACGGAGGTGTCGAT
CGTAAAGGCCCTGCGAGAGTTGCTTCCGACCATGGACGCAGAAACGGCGACTCTGAAGTTGGTGATGCAGAAGCTGGCGGTTCGCTTCGGCATGGAGTTC
CGGGATTTAAAAGCACAATGGAGACCTCACATCAAGGCGGTGCTGCCGGAGATGCTGGACCAGTGTCTGAGAGGAGAAGCGTCCGAAGAAGAGGGCGAAA
AGGACAAACACCGGGCGGAAGAGGAGGAGGAAGTTGATCTGCGGCCCAACCGGAAGCGCACGACTAGAAAGCACAATGCAGTTGTTGATGCGAGTGATGA
AGAGGCGGAGGAGGACACTGCTAGTGACAACGATGCAAGTGGAGGTGAAGAAGCTAATCCCGAAGAAGACGATGAAGAGGAGGAAGACGATATTGCTCCA
GCCAAAAAGAGACTGAAAGCGGTGCGAACGTTGCTTTTGTTGGGTCTGACCTTTTCTCCTTCTTGTTACACCCTTCGAGGTATTATATGCTGATGCCTAC
TTTTTGCTGTTCTGGTTGTTTTTGCTTGCAGTCGAACAATGGCCACTCGAGTTGGAGATCAAGTAAAAGCGATGGTCCGCCGGTGAAGAAAGCCAAGACT
GTCAAACAACAAGATCCTCCGGGACTTGCCTCGTTGAAGGAACTGGGCCGTGCAGCTGGTGTAATGAAGTACGGGCTGGGTCCTATAGTATATCGAATTG
TGTGGAAGTTCATGCTAACCAACTCGATTGTTTTGGGTTTCAGTCCACGGCTGTACAGATTTCTGAACGGTGCCACATCGACTGAAGACTCAGAAGAGAT
CCTGCGCAAGCGATTACAAGATGCTGGCGTTGCCTTTAATGGCACGTATCCATCAAGCCGCGATATCAGCGCCGCGAAGAGAAAGCACGACAAAGCAAAG
GAGCTGGAGGGCATCGACACAAACCTGATTATTTCGGGCGGGAGGTCCCGTCGTGGTGGCTCGCAGCACATTTCCTACAAGGAAGAGCGGATCAGTGGGG
AGGAAGACAACGCAGAAGAGGAGGAAGATGAAGATGACAAAGACGCCGAGGAGTTCGGTGGCAGCGACTCGGACTCGTCAGAGGCGTCATTTTGAGTTGG
CTTTTGCGTAGTGGCGATGTGAGTGCATATGCAGTAGTAGGTGGTCCTACCGCAAATAGAGAATTGCTTTCGTCTTGGGAGTGCAACGTTAGTGTTGTTT
AGCCCTTTCGTTTTTGTGATACAAGCAGTTTTTGTGGGACGATATTTGTGCACATCGACTGTCGAATCTCGCTCCAGATCAATTTGTTAAGGGCACAAAT
CGGGTTTGTGTCCCATAAAGAAAGGTAATTCCAGATCTCACTTGCATTTCGTAAGGCGTCAAATTAAAATCATGTGATTGGATAAAATAGAAAATGAACC
ACATGGGATTGGCCAAAAGTCGCCGGTAATTGCTTGTCCAGGTGATTGGTGGTGGGAGCGCGTGGCCTGTTTGGTCCCGGGCGGCGCAGCATTTGCCGCT
CCAGTTTCCAGAACCCGAACGTGAAGCAAGAATCATGCCGTCCTACAGCCAGGAACCTGAAGACGCTCAGCGCGCCGCTAAGGCCCGTGGCTCGCACCTG
CGCGTGCACTTTAAGCACTGCCGTGAGGTCAGCCACGCCATCAAGGGCATGCCCCTGAACAAGGCTAAGAGCTTCCTGCAGGCCGTGCTCGAGTACAAGC
AGGCGGTGCCCTTCACCAAGTTCACGGGCGGTTGCGGCCGTCACGCTCAGGGCAAGCTCCGCGGTGCCGCTGGCGACAAGTGCAAGTGGCCCCAGAAGGC
CACCAAGATCATCCTGGACCTGGTGAAGAACGCCGAGGCCAACGCCGAGGTCAAGGGCCTGGACACGGACCTGCTGTACATCTCGCACGCGCAGGCCAAC
GCCGCCATCAAGCAGCGCCGACGCACGTACCGTGCGCACGGTCGCATTGGACCCTACATGTCCAACCCGGCCCACATCGAGCTCATCCTGACGGAGAAGC
GTGCTAACGTTGCCAAGGCCGTGGAGGAGGTCAAGCCCACCAAGGTCTCCCGCAAGCGTCAGGCTCAGCTGCGCCTCAAGTCGGGCGGCGGCGTCCCGGC
CAACTAAGTTGATTTCTTTGCTCGGGATATCTCTTGCCTGAAACACGAACGGTCAGTCGGGAACGAGCGACTGGAGACGCGAGGGGGTGGCGAAAAGTTT
GGTAAAACTTTTTAATACAGCCTTGCCGAGAAATGGGTTCTACTGATGCAGTGTCTGTTGCCAAGAGAGCAAGCGAGTTTCCAGTTCGTCTTCATGGCGT
GTCCCTGCGTAGGTCGTTATGGTTTGCTTTGGGTGCGTACAGTAACAGGTTTGATAGCGGCGGGACGGAAGTCGGGACTGAATTTGCTGCGCCGGCTTAG
GAGATGACAGGGGAGAGTCGTGATACCACCACTATGAGGTCGTCGGAAACTGGGGTAGCTAGGATGGTGGAGCGATATCCTGTGTGCTGACGAAGACGAG
ATCACTGATGACGGCGTGGCTACCTGTGACGTTGAAGACCGAAGAAAGCAAGTCTAGCCATGCTTGTAGTCGATGCCGCGTCGGGAAGTGGACTACCCAC
ACTTGCAGCGTGCTCGGGTCTTGGACAGTCATCCACCACTTTCGGACACTGCGAGCGTCAGTCTCCTCCACAAATGTGACGAGGCTGATATTGTGAAGAC
GCATTACGTGCTTGAAGTTGCCGTAATGCAGGAGATGTTGTGTCTGGTCGAGTTGCAGGTGTTGTATTCGCTTTTGCATCTTTGGCATGAAGAAGCCCAC
GGGCTCTTCGATGTGGAGCCACTCGCTGCCGGTGGTTGGGCCCTCGTCTTCACTGACGGTGCTGTCCTCTTCGCAAGTGTCGGTGTCACGTTTCGACTTG
TATCTTGATGGGCATGGAAACCGTCGCCATATTGCGCTGAAGGCAAGCATGATTCCTCACTGCTGCTCCTTGTAGTCAAAAGAAAACATGCAACTACGCT
GCATGCATCGTGCCAAATTCAGCTTGCAACTTCGATAGTCCTCAAAAAGCTTGTTGCGTTGGTGCGTCATAAGAAGCTTTTGCCCATGCTAGGTCATTCA
CCGGAAATAGACCTCGACGTTGGTAGTGATGCCAGCCACGCTGCAGTCGCACTGCCTTCATGACAATACAGTATCAACCGTGCAGTCTGCTAGCACACAT
TTAAGCTAAATTACTGCATGCAGCAAGAGTTCGTGTGGCGCGTAGTGTCCATGGTGGTTAGTGCTGTAAAAGTGGACTAATTTTGATCTCAGACCATTTG
GGACCATTTTGGGGCGTTTGACACTAATTTTGGCGGGAAAGCGCGCATTGGTCAAGATGAAACCGAAGACGCAGAGCTCTCTGCTGAGTTTCTTCAGCCC
TCCGTCGTCCGAGGGAGCGTCGGCCAAGAAGAAGGGCGCACCTGCAGCTGCGGGTACGGGCAGTAGCAGCAAGAAGAAGGCGCCTGCCAAAACGCAGACC
AAGCGTGAGTCGCTGGGCAACACGCGCAAAAAGATCGAGTTCTCGCCCAAATTGAAGCAGAAGCCGGCAAGCGACGATGTGGACATGGAAGACGCGGACA
AGGCGAAGGCTGTGTGCGCCAAGCGCAAGGCGTACGAGGAGTTCCTTGGCACGAGCTCAGAGGAGGAGGGGGAGGAGCCCGTGAAGAAGGTGGAGGAGGA
GGCCAAGAAGCGGACGCAGTTGCGTCCTGGGAAGGTAATTATCCAAGATGACAGCGACTCGGAGGAGGAAGCCGTGGCGCCGCCCTCCTCTCGTCGTCGA
AAGGGGAAAACGCCCATTAGGAACGCTGTGAGCAGCGAAGAGGAAGACAGTCCAGAAGAAGGAGACAATGGGGAAGAGTCCGAGTTTAGCGGCGCAGAGG
AAGAACCTTCGGACGACGATGTAGACGACCTGGTGGACGAAGAGTCAGAGGAAGAAGCCCCACCTCCCAAGAAGCGTCGCATGAGTGCTCCTGTTGTGAC
CAAGACGAAGAAAATGGCGACCAAGTCCTTCCTTTCGCCTCCGCCCGCTGCCAAGAAGAATTGGAACGGCCCTACGTCAAACAGTAAGAAGTCTGTGCCA
CTGGCTGATGGTTCGGCTCTGCCGAGCTCGGTGGCGGGTGCTGGCAATCACATTCATGATTCGCTACCGTGGCTACATGAACAGCGGCGCGACATCAACG
GCAACACACCAGACTCCCCAGATTACGATCCGCGTACAGTGAAGGTACCACAAGAGTTTCTGAAGAAGGAGACCCCGGCGATGGTGCAATGGTGGGAAGT
CAAAGCAGAAAACATGGACACGGTGCTGTTTTTCAAGGTTGGCAAGTTCTACGAGTTGTTCCACATGGACGCTGATGTTGGCTTCAAAGAACTCAACCTC
ATTTACATGAAAGGCGACAAAGCGCACTCGGGCTTCCCTGAGATTGCGTACTCGAAAATGTCAGCCCAGCTGGTTGAAAAGGGCTACCGCGTTGCCCGAG
TTGAACAAACAGAAACACCTGACATGCTCAAGATTCGAAATAGCAACCAAGCAAAAAAGTCCAAGGTTGTTCGCCGTGAGGTGTGTTCGCTCCTGTCCAT
TGGAACGAACACAATCAGCTTTTTGGACGCCCCAATTTCGTCGCAGAATCGAGTCTCGAAGTACCTCCTCGCGCTTAAGGAAGCATTTGATCCTTCCCGG
AAAACCGTGCGCTTTGGCGTTTGTTTGGCAGACGCCGCTACCGGTGCCTTCCAGCTGTCTGAGTTTGACGATACCGAACAACGGGACCGTCTTAAGACGT
TGTTTGCTCAATTTCACGTTGTGGAGATTATTACCGAGCGGTTTAACATCTCTGACGATACGAAGATGGTGCTCAAACACGCAGCACCTGCTGCGATTCG
TTCGTCACTGCGCGTCGGAAAGGAGTTCTGGGATGCATCGAAAACGATCGATGAAATCGAGCGTGCAGGATATTTCAAGGAACATGGGTGGCCAGAAGAC
GTACTATATTTCTTAGAAATGGACAAGGTTGTGAAGTCCGACGGTCAACTCGCGATCAGTGCTCTAGGTGGTTGCATTTGGCACCTACGACGCAGTATCA
TCGACCAAGAATTGCTTTCTCTCTGCAACTTCAGAAGATACAAGCCTTCTGATGAGGAGACACGAGATGCTCGAGTAAACAAATCGTTATCCGCTGCGAC
GGCCGAACTGAACCAGCAGTATGTTGTTCTGGATTCGCAGACCATCCAGAACCTGGAAGTGCTTACCAACAGCTTTAACGGCACGCGGTCAGGATCTCTC
ATCGATATCATGGACAAGACTGTAACGAGTTTTGGCCGTCGAATGTTCCAGGAGTGGGTTTTAAAGCCGCTGTGTAAGATTGGGGATATTCAAGAGCGCC
TCGATGCCGTTGAAGAGCTCGGCAATAGTGGTGACTTGATGATGGAGATTCGCGAGTTTCTCCGCAAATTGCCGGACTTGGAACGACTACTATCTAGAAT
TCACGCGCTTGGATCTTCGCATCGCTCAAAGGAACACCCGGATAGCAGGGCAATCATGTACGAGTCTCAGACGTACAACATCCGAAAGATTCGAGACTTC
CTTGCCGTACTAGATGGATTTGATGCGGCGATGAACCTAACGCTTGAATTGGGGCCTCGCCTCTCTCAATCCACTTCGCCAATTCTTCAGTCACTGCTGA
AGAGATACCAAGTCGAGGACGGTGTGAAGCCGGATATTGAGCACGGACATTTCCCCGACCTGACGGAGAAACTTGAGTTCTTCAAGCGCAGCTTCGATCA
AGCTGCTGCACAGAAAAGCGGTGTAATCGTACCCCAGGATGGTGTGGACTCAGAATTTGACGATGCTTGTGCTGAAATCGCCCAGGTTGAAGCCGAACTA
AACGAGTATTTACAAGAGCAGCAAAACGCGCTGCGATGCCGTCAAATTTCCTACTGGATCCCGAAGAAGAAGGAGGATCGCTATCAGTTGGAAGTTCCTG
AGAGCGTGTTATCGAAACAGCCGAAAGAGTTTGAACTCAAGTCGCGCAGGAAGGGTTATAAACGTTTTCACACGCCCACAATTCGCAGCCTGCTAAAACG
GTTGGCCACTGCCGAGGACCACAAGGATGAAGCACTCAAAGACCAAACGCGCCGCATTTTCCACAAGTTTGATGAAGACTACAAGTACTGGATGAAGGCG
GTACAGTGCTTGGCCGTGATTGACTGTTTGGTCAGTCTCGCGCTCCTCAGCAGCCAGAGTGAAGGCTACACGAAACCCGAAGTGGTGGCGGCTATCACCG
CGAACGGAGGAACCCCTTTCGTTGATATTGAAGAGGGTGTACACCCATGCGTTGCCGCAACTTACGGCAGCGGGGATTTCATCCCGAATGACGCACGCCT
CGGAATCGAAGGAAAGGGTCAAATGGTTCTCCTCAGTGGACCGAACATGGGTGGTAAGTCGACGCTGCTGCGCCAGACGTGCGTTCTCACCCTCATGGCC
CAGATCGGCAGCTTTGTCCCCGCAGCGAAATGCCGTCTCAGCCCTGTTGACCGAATTTTCACCCGTATCGGCGCTTCAGATCGTATCCTTGCTGGCCAGA
GTACTCTTTACGTTGAGCTGGCTGAGACGGCGACGATTCTGAATCACGCTACCAGCCACTCGCTTGTGATTTTGGACGAGTTGGGACGTGGCACGTCCAC
GTTCGATGGCACTGCCATCGCGTACTCGGTGGTTGAGCACCTGCTGAGCGATATCCGTTGCCGAGCGATGTTTGCTACTCACTACCATTCGCTGGTCGAA
GAGTATGCGGGCAACGATAAGGTTTCTCTGGGCCACATGGGGTGCATCGTGGACCAAGAGAACGATCGCAAGGTCACGTTCCTGTACAAGCTGGAGGACG
GCATGTGCCCCAAGAGCTACGGTATCAACGTCGCCATGCTGGCCAAGCTCCCGGACGAAGTGATCGAGTGCGCCGCCAAGAAATCGGAGCAGTTCGAGCG
CTCCTTGCAGGCGAACTCGCACACCGAACTGGAAACCGTCCGACTCGCACAAAAGGTGAAGGAAGCGCTTGCAGAAGGCGAAGCGGGCGTAGGCAAACTC
AAACAGCTATGGGAAGAAGCACGCAGCGCCATTCGCGCCTAACTCGAACAAAAAATGTATCCATCTGACGTACGTGACCTTAATTAGGAAATCATCTGTG
ACAGAAATGCGTCAAGTCAAGTCGCTGGTGGAGCTGTCGGTGGTGGCTGCGGCGCTCTCCACGCCCGTACAGGAGCTCCTGGACTATGTGGAGCTCCTGC
CCATCGCCATCCGCCACCAGCTCTTCCGAGAGTTGCCCAACTTCCGACTGCGCGAGATGGAGGTGGCGTGGGAGGCGTCTGTCCAGCTGGGGGAGGCCCC
GGAACCGCGCGACGGCTTCGACCCCCAGGCGGGTGACAAGTTCCTGTTTGACCGAGAGACGCAAGGAGTGTGGGAGCTCCGCATGAACGCAGCAAGACTG
GGCTACGAGCCGATCCCCATCGAGAACACGGCGGCGGCCCAAGGACGCAGACGCAACCACCGGCACATCTTCTGGGAGCACCAGTTCCGCACGTTGCTCA
AGCTGCGCACGCCACTCGATTTTGCAGGGCCTGTCGACGTGCTCACAGAATGCCAGAAGCTCTTTGTGGACGTCGTGGAGGTGCTGAAAGTGCACGGCCG
AGAGGTCTGTAAGGATAATGTGGGGCTGGTCTTGGCGCTTCGACGGCTGCGACGACTGGAAGTGCATCATCCGGAACAGCAAAATACGTCCTGGGAGTCC
ATGGGGAAGTTGATGCAGGACCACCCACATCTTACTGAACTGGGGTTCTTCCACGGCAAGTTGAGTGATAACCAGATCGTGCATATCCGCAAGACGCTGG
CGAATCCGAACCTGACGGTGGACAAAAGTCTGAACTGCAGCAGAATCACGACGCTGGAGTTTGTCTCGGTGAAAATTCGACCTGAAGGGTATCGCCAATT
GGTGGCCCTGGTGATTGACATGACGCAGCTAACCAAGCTTAGATTGAGCAACACTATCACGGATTTCGACACGAAGCTGCTTGTCGACGCAGCACTGCGT
GCCCCGAAGCTGGAACAACTGTTTCTGGAGCACAATGAGCTGGAAGATGATGCATTCTTGGGGCTTGCAAAACTGCGAAAACCACTGGCACTGCGACACC
TTCGCCTCAGCGATAATGACGTGTCGCCTATAACGCTGGGGGCGATCTGCAGCGCCAGTATGGATGGCGTACTGAATCTGGAGAGACTTGAACTTACCAA
CAACGTGCAGATTGGCGATCCGGGTATACACGCACTAACACCGATGCTGGCTTCCCCAAGCGCTGGACCTGTAGCGGTACTTACGCATCTAGACGTTCGC
GGCTGCAATTTTGGCCTCGAAGGGGTGACCGCCTTGCTGCTAGCGCTGGGGCGCAACAAGACGGTCAAACACTTGAACCTCGCACAAAACTTTTTCGATG
TTGGATTTGGCGACGTGCTCGCCGATTTTCTGGTCACCAACGACTCGGTCACAAATCTGCAAGCGAATGGCGTTGGATTGGGTTTGGCAGGTGTGTCTGC
TCGGCTGTTGACAGCATTAGAGAAAAATACCATACTCACATCACTATCGTTAGGAGCGAATCGACTTCGAAATGATGGTGCGTCTGCGCTGCTGCGAGCA
CTCGTAAAGCGTGCTGAAACAAAGCCTTTCACGCTGGTTGACTTGAGTGGAAATCTTCTCACGTTGAGTGGGCTTGCGATGCTCACTGATATTTTGGAGA
TCCCTGCTAGTGCGGATCATGCTCGCCCCGGTTACGCTAGCAGGAGTTGTATTGACGGGCAAGGACAGGAAGTTTTGGCAGATCGTAAACGACGGCGTAT
CGGTAGCTTCGACTACCACAACTTGTCGAGTCCGCTTAACAAGCCAATCGAAGAGCTATGCTTGCTGAATAACGATTTCATCGGAATCGATGACGAGTAC
GCGGGTGACAGCTCGACACTAATAGAATCCATCCGTCGCCGCGTAGGGCACCTGAAGAGTAACGAGTGGGCAATACAGCACCAAGTCTACGACGACGAAG
TGTAAAGCAAATACACATATTCCGGCACTCAATATGTAAAATTCCTGAGGAGCTTCTCACACCACTCAATGAAAGGGTGTGTTCCTCATTGCATCAATAA
CCCACCTAACTACACAAAGTAGGATAAGAGAAATCCAAAGGTTCCTCCGAACCATCGACGTCGACCGTGCAGCACGAAGCATCAAAATTCACACCACGGC
AATGCCACTGAGACTGTTCTTTGACGCTGCCACCTACCTCTCGAAGGATAACGACTGCATACTCGGATAGATTCCGAATTCGCGGTCAGTGCACTGAAGC
TCGCGCCATTCACGACCTTCCTTTCGCTTGATGAGTTGGCTCTGTTTCTCTCGTAGCTCCACGATCTGCGAATTGTAAGAGTCCAGTATGTCTTGCAATG
GATGAGGAGGTTCATCCTGCTCTCCATCCGAGCTAGTGTTATCAATATCGTCCGGCACCTCAACGTCTTCGTTTAAGTCATCATCATCATCATCGTCGTC
GTCGTCATCCTCTCCTTCGTCGTAACCTTCATCTTCTCCGATTTCGTCTTCCTCTTCATCATTGGCTTGGGAATTCTCCTCGTCCAGGCGGCGCTTCTTT
GCCAAATCAAATCTCTTTCCATATTGTTCATCCTTGCCCCGCTTGGATGGTTTCTTTGAGCTATCAGAAGTAAATTGTCGTACAAGCGGATACGGATTGT
TATTGTCTTTGGAATAGTGGCCACCCTTCGCATCAGATATATTGCTTGACCCCGACCCTGCAAAGGGAAAACGCACAAGATTCGTGAGATACTCCAAGAG
ATAGCCACGTTTGAACTACTCATCAAACAGATTGATCCGACGGTCTACGTACATGCGTTATCGGACGAGCCGACAGAATGGCTATCCAGACCATCATCGT
CGAGGTCAGCGTCGGCATCGACTCCATCGCCCCATACATCTTCTTTTGCGTACCAACAACGTAAGGTAAGCTCATTAATGAAGTCGTGAGAGTAAGCAGT
GAGAGTAAGCAACGTACCTGGACTGGATTGCTTTCCCCCTGTGCTTGAGCTGTGCTCATCTGCGGCATCTTCATTGCCTGTCTGAGGCGTCTGAACTGGG
GACCCGAGAAGGGGGGATTGCTCATGATCGGAGTCATCTCCGTCCATGACAGCATCCTCGTTGCCTGTTTGGGGTGTCTGAGCTGGGGACCCAAGAGGCG
AAGATTGCCCATGGCTACCTCTATCATCTTCGATAGCACCATTTTCAGAGTTGGCATGCTTGTTGGCATTCTCTGAAAGCGCATTGATATGCGCATCATC
AGCGGTGGAGCTAGCACCAGCTTCGTAGTCAATCGCGTGATCGTGCTGCTTCGACTCTTGTTCATCGGTCACCCCCACGGGCGTGCCTAAATTCACTGTC
GGGGTAGATCCAGTGCTATCATCATTAGAAACCGCGCTTTCGTCCTGCTTCGTTTCTTGCTCGGACCTCAGCGCCATAGACGGTATAATATCTGGTGCCA
CATGTATCAAAACGAGATTCTCGAAGCCATCCAACGTGTCGAAACCTGCCCCACCATAAAAATGACACACAATTGATGATTAAGTTAAGACAGATTGGAA
GTCGGCAAGAAAGCTCAAACATCGGGGTTGCGTACGTTTTTCAAACTGGGTAAGGATATACTGGGCATCTGCGAACAAGTCTTGAAATGTGACGCCTGCA
CGGAAATCCCATGGTTAGCTCCGCACTAGTCACACAATTCAAGGATGCAAGTTTCTTTTCGAACCTGGTGTTAGGCTTGCAATTTTGGTGAAGAATGCAA
CCAAATTGTTGGTTCGGTACAATTCGATAGAATGTTGCATGCATCGAAGCACGTTATGTACCACCTCCTCAGTCCATTGGCACTGCTCTGCCACATCCCG
GACAAATGCCGCATAGTCAGTTGCGGCCAAGGTACTACTCGGTGCTCTTTTAGAAGCTGATTGTGGCGATATACCAACTGCCCGCTCGCTTCGTAAGTTG
TTTGGATGAGTAGCCCTGGAAGCAGGATTGGCTGCTGCGATGGAAGCACCACTTTGTGCAGGCATATCCACAGTCACCTTACGAGCTGCTATCGTTGTTG
AACGAAGCTTGGGCCGTGGGGCCCAGATACTTTTGCCTTTTCGCTTTTTATTGCGCACAGACAAAATACGGAGGCCTGTAAAACATCAATCAAAGGTCTT
CGTCAGCGAAATAAACTCTTGCGCTCACTTAAGAGACGATTCTATAACGTACACCGTGACTTGATCGCAAAATATCCAAGCGCGTAGGGATCGTTGTTGT
CATTCCAATCTAATCCCAACACAAACATGGCAAAAAAAGTTAAAAACAACCGGGCTTCTAAGCGCTTGAAAAAGTAGACAGCGAAGAGTCTGAGAGTTTT
ACCTGCGTTAAAGATCTTGTACGCTTCTGACGTCGGATCAAACACAATGCCCGGCAAATCTAAGATTTTGCAACGAGCCCAAGTCAGGTTACATCATCAA
AAGCAAAACCCAGTAAAACGCATGTGCGTACTTGCTGCGCGAACCGATGTTGACTTTTTCAAAAATTTCTCCCGCATGTCAGCTAGTTTGTTCATGCATG
ACCCGTCCGTTCGGTCTGACGCAAGGGAAAATATACAATGTCAGCGGCTATCAACATGATGAAACTGCACTGATACACTTACGCAGCGATTCGGCGACTT
CGTTCACGAGGTCCGAGCTCCCATTCCTCTGGATCTCACTCGTGATCCGAACGAGGAAGTCAACAAGCGTCTCCATTTCTTCGGATGACCATAGTTTTGG
AGCCTTACTGGGTGCTACAAGCTTTTCCTCTCGGCGAGCCGGGGGTACCTCGGAAAATATCTCTTTCAAAAGTTCAAGGCGTGCGATCTCCACTCTCGTT
CGCTCTTCACAGAAGCACGACCACATCCACAGATTTATCAGTCACGGTGGACGTCGAATCTGATAACCTGGAGTATCGCACTTACGACGTGAACGACGCT
TCTCCCTGATGTACAACTCACGCAGCGTGTAGAACTTGCTCTTTGACTCAGCAACCGATTTGCCTGTACATTTCCGCCAGTGCAACCAGTCACAATTTAA
AGCCCGTTTGCAGTCCACGACATGCATGAAACACTCACCCCACAATTGAACCCGCTTGAAATACACCTCCTGGGAACGAGAAAATAGTTCTCGATACTGC
TTGGCCTTCTGGAGGAAGCGACTAAGCTCGTCGGGCAGCCACACACCGCCAGACCTGTTTTCCAGTAGCTGACTAATCGACTCGTAGATGTGCTCGTACA
CATACACCTCGTGCCCATTCGTCGCGATAACTGCTCCACACGTCACACAGAATCCCAACCAATGAGTCACCTCAACCAACAGCGCCCATTGCTCCCTCTT
CGCCGCCGTGTACCTTCTGTCCGGAAGTTCTTGGTGCTCAGCACGAGGCCGAATTGCAGCATCAGTGACCGCACCATCTCCTGGATCTCGACTGCTGTTT
TACCTGCATTGCAAGACACACAAGTCAGCCTCAAGCCCCCATTATTGACGATACCAGTACACGATCTCCAATATGTTCGTTGATCGCTCGTTCTTGACGC
ACCGGGCAGCTCTGCGCGCACGACCTGTGCGAACTCGGCGTCGGACGCGTATACGTAGTGCAGCAGGTGCTTGCGGAAGAGCGACAGCAGCGCCAGGACA
TCGGTGTTGCCCCATCCGGGCACCCGCATCCTAGGCTTGAAAGTCCCGTTAGCTGAAGTTGATGGGAGCTGACCAGGATAGGTGCCGAATCTGATAGTTG
TAATATGAATGTTGCACGAGTGTAAATATGTTATGTACGCACACACCAAGGGGGACTTTTTAAACTGTTTAGTGGGAAATTGGTCCAGAGCGAGCCATGT
CGGACGCTGAGGACGAGCCGAGCAACCAGCGCGCGCTGCTGATCCCCGTCAAGAACTCGGAGCAAGCGGTGGAGGTGTATGTGGACGAGCTTCCGGATGA
CGTCAATGACATCATCGACATCCTGCGCGCAGAGGTGGCGCCGCTCGACGTTTGGCTGCAGTTCGCCGTACGTCCGCGTTTGATGAGACCAAACGCGGGA
TCAACTTTTGACAAATTGTGATTTGTGATAGGTGGAGTACTATAACCAGGGCCATGTTGCCCAGTTCCAGGAGATCCTGGCCGTGGCGTCCGAGCCAGGC
ATCGAGGAGATCTATAAAGACAATGCGTCGCGCTTGTGCCGCATCAAGTTTTTCGTCGCGTTGGCCAGCCACGCGGTCAACGCCATGTGGAACGAGGAGG
ACGAGAAAAAACGCGAGGCTATCTCCCAGCGCGCCGTGGGCTACTTCCAGCGAGCCGACCGCCTGGACCACCAGCATCCCATGACGCTCGTGGGCAAGGC
GCTAATGTTTATGGCCAAGAACGAGGACGATCGCGCGGACCGCTTCGTCAAAAGTGTGCTCATCTCCAACAAGACCAACCTGCCGGCTATCTTGGGCAAG
GCGCTGTTGCTGTACCGCAAGAAGCAGTACAAGGATGCCAAGAAGCTCTATCTGGATGCAATCAAGCTGCACCCGCGCAGCCCCCAGGCAGCAAACATGC
GCATGTGCTTTGCGTACTGCTGCTACCATTTGGGAGCTGTGGAGAAGGCGCGCGCGGTGATGCGTTTCACTGCATCGCTCGACGAGACCAACGTGGACGC
AGTGATTGCTAGCGCATTGTGGCAACTTGCGAGTCAGAGCCGCGAGGAGCGTGCCGTCAGCATCCGCGATGAAAGCTCGCGTTTCATGATGATGATCCAC
CACGCCCACGCTATCGACAAGACGAACCCGACGGTTCTGAACCACCTGGCTAACCATTATTTCTCGCAGTGGATCCCGCTTCCTTGCACGGTGAGCGTGG
TGCGTGGATCGGCAGTTGTGGCCACATCCAAGGATATTTCCAATGAAGTCTCGCCAGGTCAGATTATTTGCATCGGTGACAGGTACGTTGCCTACATCAG
CCGCAACGAAGATGCCGTGTCGCCGTCTGGGTTAAAGCTGGATGGCCCGTATCGCGAAGAGTCCGCGAGCGCTACGAATATTGCACGAAAGGATTACGAT
AAAATGTTCACGCTTGCAGGAAATGCTTTCCACAGTACCAAAATTCCGGAGATCCGCTCTGAAAGCTGCTACCTCATGGGACGTGGCTGCCATGCCCAGG
GCAAGTACAAGGACGCTTACAGCTACTACTTCAATGCTGGACGACTTTGGCCCAAGTTTGTGCTTCCGTGGTTTGGTCTGGCACAGATGTACTACGAGCG
GAAGGAATTCACGAAGGCTGCGTCTTACTTGGAAAAGGCTAACAAAGCGTATCCTGAAAACGTGGAAATCCTGTCCCTTCTTGGCGATGTGTACGGCAAG
CTCGGCAAAAAGGACGAGGCCGTTGTTCTACTTCGTCGTGTCGTAGAACTCGAGCCGGGCAATGTGGAGGCACTGATCGGCACGGCTGAGCTTTTGCACG
GTTCTCCTGAACGAAAAGACCAGATTATCGCGATTTCATCGTACATTGCAGCGGAGAAGGTCATGAACAATGCCTCGGAGCGCGTACCTATGGAAGTTTA
TGTCAACCTGGGTGTACTTCAGCAGCGCGTTGGAAAAATGGCTGATGCCATTGACTGCTTCAAGAAGGCGCTCAAACAACTGGGAGATGGCAGTACTGCT
GACCAAGAGAGCAAATCGGAGGAGGCTGATGCCATTGCCGAGGAAGCCTCAAGTCCCAAGCCAACGGAGGCCAATGTCACAATCCTGTATAATATGGGAC
GCGTCTACGAGGAAATGGGCAACCGCGATCGTGCCAAGAAACTCTACGATGGGATCCTAGAGGTGTTCCCCCGCTACACCGACTGCTTGCTGCGCCTAGG
CTGTATGCTGCGTGATCGTGGCCAGGAGGTTGATGCGACGAAGATGTTTGATAAGGTACTGGAGGTGGACCCGGCGTGTGCCGAGGCCTGCCTGTTGCAG
GGCAACATTCACTTGAAGAAGCGCGAGTGGGTGCTTGCTCAGAAGAAATTCGAAAAAGTGATGGGAATGCCCGGATTGAAGAATGACCCGTATGCGTTTT
TGTCCATGGGCAACATCTTCATGAGCAATCTCGGTGAAAAGAATCGCTACACCAAGAATATGTCGCTGAGTGAAGTATACTACAAGAAAACGTTGGCGTC
ACACCCGCACAACATCTACGCTGCCAACGGACTCGGTATTATGATTGCCGAGAAGGGCAACTTCGAGCTAGCAAAACAGATTTTCTCGCAAGTGCGCGAG
GCCAGTCCGGACATGCCAGATGCTTGGATTAATCTTGCGCACATTTTCGTCGCCGAAGAGCGTTACCAAGAGGCCATTCAGCTCTACACCGTGTGCCTTA
CCAAGTGCTACAAAGGACAGGACCTTGAGGTACTGTTGTACCTTGCGAAGGCCTTTTACGAGTCAAAGGACTTCCCGAGCTGTATTTCGACGCTATCACG
TGCACTGCACATGTATCCGAATGATTTGCGTCTTTGGTACAACACGGGCCTTGCACAGGAAGACTACGCCGTGACGACACTTGGACAGGAGACGACTAGC
ACGCGGTCAGGCAGTGGCAATGCAGTACCCCAACAGCGTACAATGGGTGATGTGCAGCGTGCCATCTTGGATTTGAAGCGAGCGCAGCGTATCTTCCGCT
TCCTGCTTCAACAAGCTGAGGTTACCGGCAATAGCGGCTCTAGTGAAAAAAAGAAACACCACAACAGTTTGCCCTTCGACAAGGAGAAGGTGTCGGAACA
CGAGAATTTCTGTGGCGACACCTTGACAAAGGCTAGCTATCACTTGGAATTCGAGCGACAAAAAGAGGAGAAGCGTCGGCTGGAGATCGAGGCTCAACGC
AAGCTGCTGCGCGAGTACGAGGAGCGTGTGGCACGTGAGCAGGAGGAAACTCGCGTAAAGGAAGACGACTTGCGCAAGCGCCACGAAGGCATCCGCCTCA
AGCAGGACGAACGTTTGAAGAAATTGCACGAAGGCTGGAGTGTGCGTGAGCGCGAGGAGGAAGAGAAAGAGAAGAAGGTTGTCAAAAAGAAAGGAGGCAA
GAAGCGCAAAAAAACCGAGGACGAGGACGGCGGCTTCATTGACGACGCAGAGGACGAATTGGATGAGGACGGCGATAACAGCATGTCGATCGAGGACATG
AAGAACCGCAACGCGACCATGAAGAAGCTGGTGGAGAAGCGCAATAAGCGTGCGCGTGTGGGGTCTGGCTCGGAAGACGAGAAGGATGACCCCACCGGAC
TCTTTGGCTCTGACTCAAGTGACGATGAACAGGAATCCAAACCAAGCGACACAATCAAGGATGATGACAAGCCTGCTGCAGAAGATGATGCGGCAGAGGA
TAGTCGTGAAGCTGAGAAGAACGAACTGTTCGGCTCTTCCTCTGATGATGAGTAAGTTGCCGGATTCAGGAAGGAGGACAGTATCGACTGCGGGCCGTGC
GCTACTAGTTTTCTTCATAAAACTTTTCTGATTGGCCTTGTCGTTGATTTCTCAAAGCTTTTTTTTTACGCTCACCGAAACTTGGACTTTATATTAATTT
TTGGCAATTTTTGGGAGTCGACTTGGCGCCAAAACGGATTTGCAACAACCAAATTTCCCGGGTTTTGATTGGCTGGGAGCGGACGTCGAGGACGAATGAT
GATCACATCGGCCGGACAAGTCTCCCGCGCTTTTTTCCGCCAGCGTGGCTCGTTGGCGCGCGGCGAGCAAGTCGAGCTCTTCTGCTTGTCATTTTGGCTT
TGGCGCTCTACTCCTCAAGCGACTCCTCCAGCTCCACCGCGCAGTCGCTCAGCTTCTTCTTGCACCAAGCAAGCAAGCAGCTACCCAACCCGTCCAGATA
GAATGGTCGCTGCCTCGTTGGAACGCGCTGCCGCAGACAAGTCGCCGGAGCAGCCGGAGCAGGAGCTGAGCCCGCAGTTCGTGGAGGGTTTCGCCAAGGT
AACAATGGAGAAGAAGGAGGAGCCGAAGCTCGAGATGTCCGAGTACAAGTTGAAGGAGGTGAACGGCGAGCTGCAGCCGGAGCCGTTCCTGGTGGAGAAC
CCGAACCGGTTCGTGCTGTTCCCGATCCAGGAGCACGACGTGTGGCAGATGTACAAGAAGGCGGAGGCGTCGTTCTGGACGGCCGAGGAGCTGGACCTGG
TGCACGACCTGAAGGACTGGGGGAACCTGACGGACAACGAGCGCCACTTCATCAAGCACGTGCTGGCATTCTTCGCTGCCAGCGACGGCATCGTGAACGA
GAACCTGGCGATGAACTTCAGCAATGAGGTGCAAGTGCCGGAGGCTCGCTGCTTCTACGGCTTCCAGATCGCCATCGAGAACATCCACTCGGAGGTGTAC
TCGCTGCTGATCGACACGTACATCAAGGACGCCGTGGAGAAGGATCACTTGCTGCGTGCCATCGAGACGATCCCGTGCGTGGAGAAGAAGGCCCGCTGGG
CGCTCAAGTGGTGTGACCCTCGTGTTTCGTCCTACCCGGAGCGTCTGCTGGCGTTCGCCGCCGTGGAGGGCATTTTCTTCTCGGGTTCCTTCTGCTCCAT
CTTCTGGCTCAAGAAGCGCGGCCTCATGCCTGGTCTGAGCTTCTCGAACGAGCTCATCAGCCGGGACGAGGGCATGCACACGGACTTCGCGTGCCTCATG
TACTCGAAGTTGGTGAACAAGCTGCCGGAGAGCCGCGTGCACGCGATCGTGCGTGACGCTGTGGTGATTGAGCACGAGTTCGTGAGCGACTCGCTCCCCG
TGGAGCTGATCGGCATGAACTCTGCGCTCATGTGCCAGTACATCGAGTTCGTGGCCGACCGCCTGCTGTACTCACTGGGTGCATCCAAGATCTACAACGT
GAAGAACCCGTTCGACTGGATGGATATGATCTCGCTGCAGGGCAAGACCAACTTCTTCGAGAAGCGCGTGGGCGAGTACTCCAAGGCTGGTGTGGGTGTC
GCGGCCGAGGACCAGGTGTTCACTCTGGACGCAGACTTTTAAGTCCGTGTCTAAGATGAAAGTGTGGGTCGTCCATGTCTTCGCCCGCAGCGCACCATGC
AGCCCCTCACCTCGCGTGGTTCGAAAGTCTTAAGATCGCAGCGGCAGTGTATATAGCCAGCTTCGTTGCATATTTAAAAAATCAACGTTGAGTCTACAAC
CTCTCCTCTTTTTTCTGCTATGACATCCCAATCGGGAGCACCTGGTAGCTGGTAGCCGCGTTTACCTGTACAGTATTGAGGACTGAGGCACGTACTCGTA
CAGTATACACGTCATGAGCTAGCTAACATCAACCTGGCGTGGCAACTTTAGTGCGTTCATGCTTCTTCATTGCACGTTTGCATCAAGTGCAACCTCCATC
AGGTTTTTGTTAAGTTGTTAAGCGGGCCCTTGAACTGGGTCTGTTTGCAGCCCTGACTTGGTTTTTGGATTGGATTGGGTCGCAAAACTGGCCAAATCTT
GCCACCGTGCGTGCAACCAAATTTGTAAACGCCACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGTTGATGGAACTTGGCGTACGACGCAGTTGTTCCCGCACTTACAGAAATCATAAAGAAATACCCTGAGGAGTTTGCCGGAAAATCCCCAACTAC
AGACACCGTGGCCGTCGATGAAGAAGCTTTGATGAGGCTCAGGAGGAAACGAAATGGTGATTCCAGTGGTGATTAATGATGCAGGCAACGAGGCGCTAGT
GTAGTTAAACTGGGAAGATGGATACTTTTTCGTTCCCTGTTCACAATTAGTCTGAGTTCAAAAGTAGTCTGTGTTCAAAATTAGTCTGTACGCGGTGGTG
ACAGACTATTTATTAGTGTAAGTTGATCTGGAAGCAGCTCACAAAAATTAGTCTAGGACAGACTAATTACTGTAATGACTGCACCAGGGGCTCACGATTG
GGATGTCATACAGTCACACCTCTATAAGTGACGCCCGATCTGTCTGATCCGAGACGTTGTTTCATTTAGAGAATGTGTCAGATATGGGAATGGCTACACT
TACATTGGTGTTAAAAAGGTATCCAGTGATGTCTGCCGCCGCCGCTTCACTACTTGGTCTCTAGCTACCATTGTCAAGGTCTGTATCATTTCCTGTTCCC
GCTTTGTATCCCCTTCACACTGGAATAGAAACGAAGAAAGCTCCATACAATAGGCGAGTGCTGTCGATGCTGACAGGGGGTTTGTCGTTCTCGTCGTCCA
CATCACCATCCACCTCTTCAGCATCATCGTCCCCGGCACCGCCTCCTGGGAGCTCGTGAATTTCAACGTCAGAATCAATCTCCAAGTAATGGGCAACACT
GTCGTGGGCTCCAGCATGCTCACAATATCGTTTACCACACTTTCTTCAGCAGCCAACGCATACTCCCCTTCCTGGCGGAGCTCCCCCAACAACGTAGCGT
CTACGATCCTTGAGTCGCCTTCCATTGCGTCAAGGCACCAGCGGACAAATCGACGATGGTAGCGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATACAGGGCCATGTTGCCCAGTTCCAGGAGATCCTGGCCGTGGCGTCCGAGCCAGGC
ATCGAGGAGATCTATAAAGACAATGCGTCGCGCTTGTGCCGCATCAAGTTTTTCGTCGCGTTGGCCAGCCACGCGGTCAACGCCATGTGGAACGAGGAGG
ACGAGAAAAAACGCGAGGCTATCTCCCAGCGCGCCGTGGGCTACTTCCAGCGAGCCGACCGCCTGGACCACCAGCATCCCATGACGCTCGTGGGCAAGGC
GCTAATGTTTATGGCCAAGAACGAGGACGATCGCGCGGACCGCTTCGTCAAAAGTGTGCTCATCTCCAACAAGACCAACCTGCCGGCTATCTTGGGCAAG
GCGCTGTTGCTGTACCGCAAGAAGCAGTACAAGGATGCCAAGAAGCTCTATCTGGATGCAATCAAGCTGCACCCGCGCAGCCCCCAGGCAGCAAACATGC
GCATGTGCTTTGCGTACTGCTGCTACCATTTGGGAGCTGTGGAGAAGGCGCGCGCGGTGATGCGTTTCACTGCATCGCTCGACGAGACCAACGTGGACGC
AGTGATTGCTAGCGCATTGTGGCAACTTGCGAGTCAGAGCCGCGAGGAGCGTGCCGTCAGCATCCGCGATGAAAGCTCGCGTTTCATGATGATGATCCAC
CACGCCCACGCTATCGACAAGACGAACCCGACGGTTCTGAACCACCTGGCTAACCATTATTTCTCGCAGTGGATCCCGCTTCCTTGCACGGTGAGCGTGG
TGCGTGGATCGGCAGTTGTGGCCACATCCAAGGATATTTCCAATGAAGTCTCGCCAGGTCAGATTATTTGCATCGGTGACAGGTACGTTGCCTACATCAG
CCGCAACGAAGATGCCGTGTCGCCGTCTGGGTTAAAGCTGGATGGCCCGTATCGCGAAGAGTCCGCGAGCGCTACGAATATTGCACGAAAGGATTACGAT
AAAATGTTCACGCTTGCAGGAAATGCTTTCCACAGTACCAAAATTCCGGAGATCCGCTCTGAAAGCTGCTACCTCATGGGACGTGGCTGCCATGCCCAGG
GCAAGTACAAGGACGCTTACAGCTACTACTTCAATGCTGGACGACTTTGGCCCAAGTTTGTGCTTCCGTGGTTTGGTCTGGCACAGATGTACTACGAGCG
GAAGGAATTCACGAAGGCTGCGTCTTACTTGGAAAAGGCTAACAAAGCGTATCCTGAAAACGTGGAAATCCTGTCCCTTCTTGGCGATGTGTACGGCAAG
CTCGGCAAAAAGGACGAGGCCGTTGTTCTACTTCGTCGTGTCGTAGAACTCGAGCCGGGCAATGTGGAGGCACTGATCGGCACGGCTGAGCTTTTGCACG
GTTCTCCTGAACGAAAAGACCAGATTATCGCGATTTCATCGTACATTGCAGCGGAGAAGGTCATGAACAATGCCTCGGAGCGCGTACCTATGGAAGTTTA
TGTCAACCTGGGTGTACTTCAGCAGCGCGTTGGAAAAATGGCTGATGCCATTGACTGCTTCAAGAAGGCGCTCAAACAACTGGGAGATGGCAGTACTGCT
GACCAAGAGAGCAAATCGGAGGAGGCTGATGCCATTGCCGAGGAAGCCTCAAGTCCCAAGCCAACGGAGGCCAATGTCACAATCCTGTATAATATGGGAC
GCGTCTACGAGGAAATGGGCAACCGCGATCGTGCCAAGAAACTCTACGATGGGATCCTAGAGGTGTTCCCCCGCTACACCGACTGCTTGCTGCGCCTAGG
CTGTATGCTGCGTGATCGTGGCCAGGAGGTTGATGCGACGAAGATGTTTGATAAGGTGCTGGAGGTGGACCCGGCGTGTGCCGAGGCCTGCCTGTTGCAG
GGCAACATTCACTTGAAGAAGCGCGAGTGGGTGCTTGCTCAGAAGAAATTCGAAAAAGTGATGGGAATGCCCGGATTGAAGAATGACCCGTATGCGTTTT
TGTCCATGGGCAACATCTTCATGAGCAATCTCGGTGAAAAGAATCGCTACACCAAGAATATGTCGCTGAGTGAAGTATACTACAAGAAAACGTTGGCGTC
ACACCCGCACAACATCTACGCTGCCAACGGACTCGGTATTATGATTGCCGAGAAGGGCAACTTCGAGCTAGCAAAACAGATTTTCTCGCAAGTGCGCGAG
GCCAGTCCGGACATGCCAGATGCTTGGATTAATCTTGCGCACATTTTCGTCGCCGAAGAGCGTTACCAAGAGGCCATTCAGCTCTACACCGTGTGCCTTA
CCAAGTGCTACAAAGGACAGGACCTTGAGGTACTGTTGTACCTTGCGAAGGCCTTTTACGAGTCAAAGGACTTCCCGAGCTGTATTTCGACGCTATCACG
TGCACTGCACATGTATCCGAATGATTTGCGTCTTTGGTACAACACGGGCCTTGCACAGGAAGACTACGCCGTGACGACACTTGGACAGGAGACGACTAGC
ACGCGGTCAGGCAGTGGCAATGCAGTACCCCAACAGCGTACAATGGGTGATGTGCAGCGTGCCATCTTGGATTTGAAGCGAGCGCAGCGTATCTTCCGCT
TCCTGCTTCAACAAGCTGAGGTTACCGGCAATAGCGGCTCTAGTGAAAAAAAGAAACACCACAACAGTTTGCCCTTCGACAAGGAGAAGGTGTCGGAACA
CGAGAATTTCTGTGGCGACACCTTGACAAAGGCTAGCTATCACTTGGAATTCGAGCGACAAAAAGAGGAGAAGCGTCGGCTGGAGATCGAGGCTCAACGC
AAGCTGCTGCGCGAGTACGAGGAGCGTGTGGCACGTGAGCAGGAGGAAACTCGCGTAAAGGAAGACGACTTGCGCAAGCGCCACGAAGGCATCCGCCTCA
AGCAGGACGAACGTTTGAAGAAATTGCACGAAGGCTGGAGTGTGCGTGAGCGCGAGGAGGAAGAGAAAGAGAAGAAGGTTGTCAAAAAGAAAGGAGGCAA
GAAGCGCAAAAAAACCGAGGACGAGGACGGCGGCTTCATTGACGACGCAGAGGACGAATTGGATGAGGACGGCGATAACAGCATGTCGATCGAGGACATG
AAGAACCGCAACGCGACCATGAAGAAGCTGGTGGAGAAGCGCAATAAGCGTGCGCGTGTGGGGTCTGGCTCGGAAGACGAGAAGGATGACCCCACCGGAC
TCTTTGGCTCTGACTCAAGTGATGATGAACAGGAATCCAAACCAAGCGACACAATCAAGGATGATGACAAGCCTGCTGCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGGCGCGCGACTTCCATACCTGACCGGAGCGGATGTTGACTACGCGCACGTGGTAGCGCACCTTGCCGT
CCTCGGACGAGTCCACGGTCGGGATCTGCACGCGCACGAGGCACTTTTCATCCACGCGGCCCAGCTCGCCATTGCGCGAGTAAGCGTAGCGCGCGGTGGG
GTTCATCGGCGGAAAGGATCTATCAGGGCGGGGCTTGGACAGTGCGTGCAAGCAGGCGGGTTGGCGAATGACGCATGATATCCGCTTTGCATCGCAGTCG
CCCGACGACGACCAGACGTCGAGAGTGCTTGACGTTCGTATGGAGCTCCTCGAGTAAGACGCCAGGGGTTTCAACAGATTTTCGGCCAATGGGACGGGCC
CGATGGGCCATCATCGAGGTCCCACCTTGATCATAGTTGCATCTAGCTTCAGAGAGTCGGAAATGACTTGATATTTGTATGCCCTCCCAGCGAGATAGCC
GGTACGTTTCACAGAACCTGTGGCTCGGCTCCGATGTGGATTGTGACGTCAGCGTTACGCAAAAATTGTCCCGACATTCGGCTGTCGCTGTCGCCGCACA
TCTGGCCCTGCAGTCTGCAGTGCAGACGGCGGTCTAATGACACTGTCATTATGACCGGCAGCCAAGTCCTGAGGAAAGGGCGTCGGTGCGTGCGCATTGG
AAAGCATCAGCGCTCCAGCGTCTGCCTCACCTCAGTGACGAGGAAACTTCTTAGCCGAGCACGATACCAATAGAGTGGTTTCAGATGGCATCCCAAGCGT
ACCTGGAAGATATATCTGTTTCTGGTTTTGCGCTTCTCGCTGCAATTGTATTCCGGCGCCTTCAATGAACGCAACATCAGTATCCAGCTGAGCAGCGTTA
ATCACGTTTGTATCAGCAGCATGTGCTGCATGGCAGCGGACACTGCTTGGTGTCCCCTGGGATTCGCTCGCCGCACTAACGGTCCTTCGGATGGACAGTC
GTGATAAAAATCGTGGTGAGACCAGCGCACGATTCTGGAGGTGGATGACGGGCATGCTGCGGATCACCTGACGATGTGTTCAGGGCGCAACTACGGTCGA
GAAAAGTGGTTTTGCGCTCTCTTATCCGAATGTTGGATCTGAGCGCTTCTTATTCTTGGCTCACGCTGGCAGGCAAGATGCCACAGCATTCTCACCGTCG
TTGGCATACAAATTGCAACGAGCCTTTGTTGGCGGGTGCTACCTAACTATCATCTGCTGTTTTGGCACCAATCGTCTGTTAGGTAGAATACTTGTCAATT
GCTCGCAAATGACCTAAATTGCATATTATCGACGTTCCACGTCATTACCAGCCGCGCTTCGCGTGACTGTGGTTCGCTTCGCTCGCGATATGAAGATAGA
ACCTCGAGCCGCACGCATCGCCCTCACGCTTGAGGCTCCGGCGGAGGGGGGGGGTTCTGTCCCTGACGCTGCGGAAAAATAGTGTTTGGCGCTCAAACAG
TCTTCGTGATAGCTTTCTCCTTCCCATTCTTACTCCTAACGTTAGTAGCAGACTGGTAGATCAACAGAAAAGTAGTATTGACTATCTGTCGAAATGCAAC
AGGTAAGCAGGGGTTGCAACAGGCGATGGGATCACAGGTAGGCAGGGGCAAAGCAACAGGTATTAGTTATTTTCCCTTGTTGGCCATCACTGTCTACACG
ATTGATTTCGTTGCATCCTTAGCAACTATGCTTGCGGTCTGCTGCCATGCGTGTCCTGACTCGGCTCCTCTGCATCGTCCATCACTTCATCAGCCTCCGC
CCACACTGCAACGCAAAACAAACGATACCGGTAACATGTCAAACTTCCGTCGCTGCATTCATCGTCACTACAGCAATACGCACCTGGTTTGTTGGATCCT
AGCTTCGGCTTGTCAGGCTTGGCGATGGAGACACGCAGCGTCCGCCCAAACAGCTCCGAATCTAATGATCACAGCCCTTTAGACACTGCCACACCACCAT
CCACAGACCACCATTAAGCATCCACCCACCGTCCATATTGTCAATAGCAGCTCTCGCATCCGCCTCGTCCTCGAACTCCACGAAACCGAAGCCTTTACTC
CTCTCTGCTCCATCAGCCAGTTAGTCGTGCACATGCCAGTATTACACCAACCCAACCCAATCGACGTACGCGTGGAGTATTCCGTGGGGATCTGCACAGA
CTTGACGGGGCCGAAGGGCACGAAGGCCGTGTACAGCCCCTGCTCCGTCACTTGCTTGTCCAGGCCGCCCACGTACAGCGCCCGCTTGTCCGCCTTGCCC
GCCATTCTGTCTTTTTAATGACCGGACTCTCCACTAAGTACGACCTGATCTTTTCCGAAACGCCTATGCAGATTTCGAAAGCCGAGGAGGCGAAGCAAGT
GAGCGCCTCGTTCCCAGCAGGATATCACCATGAGCGCGGCCACGGACGAGCTGTTTAACCAAGGTGCGTGATAGAAGAGAGACGCCTAGGTGGACATGCG
CAAGCCACGTTTCGTGCCTCGCCGTGGTTGCGGAGAAATCGCGACGCAAAGTCAGCGCTTGGACTGATAATTGGACGTCTTTTTGCGACCGGTTGGGGCG
ACGTGCTGAGCAACATCTCGCCGTATGCGTGGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN