Description :
From Genome Similarity Track
Location :
contig_29:349788- 352539
Transcript NameFunction/comments
g7145.t1KUF81784.1 Phosphoenolpyruvate carboxykinase [Phytophthora nicotianae

Sequence
2751 bases(100 bases per row)
GTGACCAAGTCTCGGTAGAAAGAAAATAAAGTTGCAATTCAGGAAGGTGCCAACGTTGTGCCTCCCACATTGTTGTCACCAACGCTTATTAACGGCTAGG
ACATGGACCTTACACGAGCATATTCACGATCTGTGACTCGATTCAACTGATAGCTTTCAAGCTGAGCCATTTCGTTCGACAATCGAGCAATGTGCATATC
CACCTCACCCTTCAAGTTCAGTGGTAAGACACGACATAGAAAAGTGCTGAGGGTGTGCCAGCGATGAAATCGTAAAATCCTGTACGACTTTACTATGGAA
AGCTACGTGTGTACTTAAGCCATCCCTCGGGTCGACTTCTATTGGCGATTCGATGGCCTCAAGGAGTGACTTGGCCGTGGGTCTGTTAGACGAGTAGTTC
TGCAAACACTGTGTTTTTACTCTTTCCAGTTCAGCTGGAAGATCTTAGATAGGTGATGTCTTCAAAAGGAAGCCCACGCTCCAAATGTCAGCCTCCACTG
TGTAGGACAATGATAATAATATCTCGGGAGCATGCGATTCCGCCTTCAAAGGATCTACTTTTGCAGCCGGCGACACTGCTCCATCATCGAAGTCAATAAG
AAACCACTGCCGCCTTCGAGGTACCTCAGCACACTGTCCCTCGATGCATCAGATTGATTGCATGCAGTGCCACCAGCGCCGTCAGGAGCTAGCGGACATT
TTTAGGCGGGGGAAGTCGACCAACGGATACCAGCGTCAGGCTTCCTTAGCTTCACAACGTTCGGGACTGAATGTCTCTTTCATTCGCTCATGCAGCATTT
TCAAATGACTAATTATGCCGTCGCTGGGCATGCTCGAGGGATACGTCTTCACCACACAATCATCTCCACACCATTGACTCTTTTGACAGTCCTGAACTCG
TGTAACCCAGCGGTCGGAAAAGAGTCGAAAGGTTGAGCATGGCGAGAAAGAACGAAAGCCGGCCATTGAGATCACCAAATCGTACGTTTCAATGATTTCC
ACTTTTGCACCACGCTCCGTCATCTCGTCTTTCCGAATAGCTTACCAAGCACACTTGCAGTCCCACCGCAGCGTAGCCAAACACGTACGGCGCAGCGTCA
TATCTCCACGTTAGTTTCTCACGCAATTCTTTAAGCGGCACTTCCATCTTGCCTTGCTTCTTCCCGTAAAACACGCACCATTGCTATTCTTGCAGTAGAA
GCAGACATCTGGAAAACGAATTCGTGCTGCGACGAAAGTTTCCGTTTGGCACACGCCTCAGGAGTACCGAAATGATGGGGTCCCACAAGTGATGATATAG
TTCTTCGATTTCATCCTCGGCGCCAGACCTAGGGGGGTCAACAACGGAGCCCACGAGAGTCGCAGTTCGGTACGAAAGTTTTTCACGCGGTTCGAGGCTT
GTTTCGTGATGCTCTGCTCTGGTCTCTTTTCACAGTACCTATCTAGCAAAGCTAGCACCTTATGCAACTATTTCGCTGCGCATTGGCTTTGCTGCGGATA
CAGATCCGCCAGCCAGTTTTAACATTACCGATGCTGGAGAGAACAGTGATCTTCGACAGTGCCATGCCTTGCCTTCCTACCTTTTTCACCAAAAACCACC
CATACTTGTCAAGAATAACAAACATGCTTTTGCGCGGTTGTGGGCCTCCTTGTTCCCGAGGAAATCCTCGAAGGGCTTGATAGCCATACCAACAACAGCT
CTATTTTTTGTTTGCCGTGGGAGAATAATGTGGTTGCCTGCGTTGCCGCTCTTCGCTGCCTTGGTGACTCGTCGTCCCGTGTGCTCATTCGTGGAAAAAC
CAACCAATCGCCACCTGAATACTCGCTCGCTTCAACTTGCCAGAAGGCTCCCGAGGCTCGCCTTTGAAGGTACGACGACAAGGACGTACCAGAACAAGTG
TCGTCTAGTAGACCCTAGCAACTATTGCCCTTTTCTACTGCAGTTGCTTTTTCTTTATATTTATTCGAGTTCGATGGAGAGTACATAGCTAGATGCACCC
CTATAGGAGGCGCAACTACGGGAAAAACACCTACACATTGGGTCCGTACACTGACAGGTCGTTGCCCGGCAGGATGAACTGCTTGAAGTTCTCCTTGAAC
GACTTGGCCAGCTTGAGCGCCGTCGCGTCGAACGCGGCCTTGTCGGTCCACGAGTCCTTCGGGTTCAGGATCTCCGACGGCACGCCCTCCACCGTCGTCG
GGATCTCGAAGCCGAACAGCGGGTCCTTGACGAACGTCGCCTGGTTGATGCTGCCGTCCAGCACCGCGTCCACACACTTGCGCGTGTACGGCAGCTTCAT
GCGCTTGCCCACGCCGTACACGCCGCCCGTCAGCCGTGTTGATCAGGTACACGTGCGTGTTGTGCTCCTGTAGCTTCTTCTTCAGCAGGTCGGCGTACTT
GGTCGGGTGCAGCGTCATGAACGCCGCGCCGAAGCACGTCGAGAACGTGGCCTGCGGCTCCGTGATGCCGCGCTCCGTGCCCGCCACCTTGGCCGTGTAG
CCCGACAGGAAGTGATACTGCGCCTGGCCCGCAGACAGCTTCGACACGGGAGGCAGCACGCCGTACGCGTCGCACGTGAGGAAGATGACGGCGTTCGGGT
GGTTGCCGCGCGAGTTCGGCTGGTGGTGCGGGATGTGGTAGATCGGGTACGACACGCGCCCGTTCTCCGTCTTGCTCGAGTTGAAGTAGTCGGGCTCGTT
GTTGGCGTCGATCCAGACGTTCTCCAGCATGGCGTTCGGCCGGATGGCATT