Description :
From Genome Similarity Track
Location :
Scaffold_110:34973- 37559
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_110-snap-gene-0.20Conserved gene of unknown function
Pytir_DAOMBR486snap-pir_contig_110-abinit-gene-0.63Histidyl-tRNA synthetase

Sequence
2586 bases(100 bases per row)
GATTTACCCGAACAGACCGATCTGGAGAGCTGGTCAGGTTTCATGCTCTAAACCCAAGAAATCGAGAGCCAAGCCTGGAGTCAAAGTATAAGCCAAAGCC
AAAGCAACCAAAGCTGAAGCAGCCACAACGAAGAAATCGGCGACTGCGCGGAACAGAATCGAGCAGCCAATTGCTGAAACGTCGAATATCAAGAGAGCGA
GAACCACGCTCCCCAGTGACCGCCATTCCCCACTTCACCCTAGACAGCACGGGTTTGCTCTGGACCCCAGACTCGCGAATCTGCAAGAGTTGGAGTGGAT
GCCACACGCTGGCACGCGACAAGTGCCGGCCCAAGAAATCGTCAAGGCAGTGGAAGTGTTGAACACAAAAGTTTGGTCTGTGGACGCCATCGAATTGTGC
CTCTATCGCGTCTCTGAATCGCAGCTACTCCTCCACTCGTCATCTCTTGCAAACCATCCGCAGCAAACCTCTCCAGTCGTCAAACTGAGCTTCCCTGCGC
TTCATCCATTCACCCATTCATTGTTCCATGAGCTAAAAACTCTGTGTGTACCTAGCCATCCAGTTATTTACCAATTGGATGACAACCATCACACAAATTG
CTTCCCGCCACTTCTCTTCAACAGCAACGGCTTGGACGACAAGAAGCAGGAGCTGCTCAGCGGTGCCACTGCGATTCCGATCTCCTAGTTCAGCGACGAC
TCAAACGGCCTCCGGTCGGAATACCGCGCGCACAACAGGTACTGCTCCAAGAAGCTCAGCACCAAGGACAACAAGCTGGTAAGCGTTGTAGGCGTCGCTG
TGGAAGAACGACCTCAGAAATCCGCGTTCTTGTGAGAAACCGCGTGTAAATGGTTTGAAGAGGGTACTTTAATTGGCGGCCTTGCGAAAAAAACTCACGA
ATGACATGTACAAATAATCTTTTGAATGGTTATTTGTAATACAAAAATTCGGGGTTTGATTGACTCAGATACGTGAACTCATCTCAATGAACCCATTCGT
TTCACATCAAAAAGCTGTTTGGCGAAGGGATGAAACCAACGCAGCATTTGTAGCATTTCCCTGTCGACCCACAACGTCTGCTAGAAAGAGTTGTCCCTAC
CTCCCGCAGCCCACAATGATGGCCGACCTGGAGCTCAGCGCCAACCAGCAGCAGGACCATCATCAGGATGACCCCCAAGTGGAATCACCTCTCAAGCCAC
AACAGCAGAACGATGAAGAGTACCCGGAAGAGAGCCAAGCGTCGCCATCACCTTCCTCTTCTTCGTCATACGCTGCGACCGCCAAGCTCGCGTGGGAGTG
GGCGTGCTGGTCCGGCGAGAAGACCTGGGACGGGCTTGACTTTGCCGGCGAAGTGGTCGCAAACTTTCTCGGGCTCACGACCTCCAAGTACCAGTGGATG
ATCGACATGCAGGAGCGCGAGGACGAGGATCGGCGGCAGCGCAAGCTGGAGGCCCGGCAGCGGCGCCGGCTGCGTCTCGAGCAGCTACTGGAGCAGGAGA
AGCGCAAGCTACAGGAGCTCGAGGCGGGTGAATGCGATGAAAGCGATGCTGATGATCTGGAGAGTCGTGATACAAACCAAATCGAAGGTGGACAGTGCTG
ATAAATAGGAACTGCCGCAGACCTGAAAACAACAAAAAGTAGTTCGCATGGTGTTCTCTATTGCGTGTTTACTCTGTGAACTAAGGACTCTTTTGTCGTC
ATACCTAAGCCAACCAAACCAGAGGTCACTCTCATTCCAGTCTCGCTTCTCGTCCGCTAGAGAAACTCAAAGGCGTCCAACTTGGCGAGCGCGACCTGCT
CTTCCTGCCGTCTCTCCAGGTTCTTCACCTTGACGAACTTGCTCTTGACCTCTTCGCCGCCTAAGATCACAGCGTGCAGACATCCATACTTCTCAGCAGC
CTAAATAGGAAATATCGGTAACAACAACAGCAACGTTGTGTGAGAATATTTGCTAACAAAGTTGATGGACTAATCTTTGCTATACTCTCAACATTCATCG
GTCGGTACCTTCATCTGCTTCTTCAGGCTGCCTTTGCCGTGGCAAAAGTGGACCGCAAGTCCTCGCTGGCGCAGCGTCTGGAGGTACAAGTGACGGTAGT
TTGGTGAGTGCGTGTGAATGTTAGAGGCGAATAGTACGGTCCTCCGATAAAAAGGGGCAAAACGTACGTGAGCGACGCGCATGGACTCGTGCAGCACAGC
GTCTTGGTCATCGCCAACGAGCACAGGGATGACCTGCATACCATCATTTTGAAGAGACCACGTGTGTTAGTACTCAAAGTAGCATTTCCACAGCACATAA
AGATCACAAACAGGTCGCTTACAGCGATGGTACGGGATGACTTTGTCTCAGTCTCACGAAGTAAGTGGAGGCGGTCCACGCCTGCTGCCCAACCGATGCA
CGCCACTGGCGGTCCACCCAGGGTCTCCGAGAGGTTGTCATAGCATCCACCCGCTAGCACAGCGATGCCGCCATTCCCGGTCCCTCTCTCGTCTCCATCG
TCAGACGACGACAGATTCTCAACAAACTCAAACACCGTGTGGCTGTAGTAGTCCTGTTTGAGTATGTCAACAGCGAGTGACAACAA