Description :
From Genome Similarity Track
Location :
scaffold_155:34973- 52810
Transcript NameFunction/comments
Pl_108633protocadherin-like protein
Pl_108634hypothetical protein PHYSODRAFT_493579
Pl_108635hypothetical protein PHYSODRAFT_494196
Pl_108636conserved hypothetical protein
Pl_108637transposase

Sequence
17837 bases(100 bases per row)
GTAGTTTCATCATGACCACCTCTTTCATCGTCAACAGCAACACGAATTTTGTAGACAGGGGTTTTCTCAAAATCCAAACTGCCGACTGCCCATAACCGTG
AGCCTTGGATAGAAAAGACATCACTGCCTGACAACAAAGAAAACGTCAGTATCGCCCCTTTGTCCTCATCAAAAGCGTATTCAGCCAGATTGCCAATCAA
ACAATCATTTCCGATACAATTTTCTAGAACGTGAAAAACACTACTTGTTAAAACGGGAGGATCATTACAATCCGTGACTGCAATATTGTAGTCGCACGTG
ACTTGAAGACTCGTTTTGTCCGTAAAACGGACTTTGAAGAGGACAGTATCATGGATTTCAAAATCGAGAGTTCCCTTTAAAGACAATGTGCCAGTTGTTG
GGGTGATAGTTAGCACCCCTAGAACACTTTGCGAAAGTAACCCGTACGTTATAAAATCATCAACGTCTTGGTCCGACGCGTAACTACTCATGGATCCGAT
AGCCGTTCCTACTGTCGTATTTTCTGCAACACTAAACGAGAAAGGGGTACAAGTTGGTGATTCTGGGATGTCTTGGACAGTAATTACAATACTAGCGTGT
CCTTCCAATCCACCTAAATCTTTGGCGACAACATCTAACACAAACTTGGGGGTTGTCTCGAAATCTAGTGACTTAGTTGCAACTATAGACCCTTCGTGAT
TGACCACAAAATTGCCATTTCCACCGCTAGCAATCGACAAGGTATAGGAGTCGAACGCATCTGGGTCATTTACACCTAAAACAGGTGCAATGGAGACGGG
GGGTAGAACATTCTCTTTGATTATTCGGGAAGCTTGATAATTCACCACAACGGGAGCTTCGTTAACATCCACCACGTTCACACGAATTTGGCATGCTGCA
TATGGCACAGAAGATTGTGTCTCTTGAATTATAAGGGTCAAATCATACGTGTTTTGAGTTTCAAAATCTAGTGCTTTTAGAAGGGCCACATGGTTCTGGT
TATCCAACTTGAATATACTTGTGACGGAGGTTTCAAGTTGGTACGTCAGACCAGGAGGAGTTGCAATCAAGCTAAAACTGATACCAGAGACATACCCAGC
ATCATTCTCGTTAATGTTCAATATGTGCTTTTTGTTCACACAAATCGGATCCTGAAAGACGTAGGTCAGTGTACGGACACCACCTGAGCAACTATACCCA
GGAGGACATTTTTTAAGCTCGTATCGCTGGCCATTAGAAGCATCCTCGGGGAGAGCATAATAACCCGCTGGAACATTGGTAAAATTGTAGTACGATATCG
CTTGTGAGAGCGGGAGTACCAACTGTAAGTTATAACTCGATCCTGGTGCGACAGCATCAAAAGTTGCTGGTGTTGAATTATCATTGATCCCCACAAAAAC
AAAACCGAACGATGCAGAATCAACAACAACCGGAGGCACGCCATACCCAATTAGCCAGGCTCGTAATGAAGACGGAAATATCCCCAGGGTGGTACCAATT
ACAATTACAATATCACCGGAATTTATCGCAGATAATGTGGATAAATAGCTGGATGTTGATGAAGTGTCAACAATGTTAGAAATTTTTTGAACTCCTATCC
CAGAATATACCAAAATTTCCAAAGAATTCGTGCTTTGTGCAAGATTTCGTACCACATCTCCGTTAAGTATCACAGAACCTTTACAAGTCGTTGTCATAGT
GGCGCACAAGGAAATATCAAGATTTAGCAAAATAGGTTGTCCATCCAAACGATCACATCGTAATAAACTGAAAATCGTGTCCGATGTTTTTCTGAACAGA
ATAGATCTTTTCACAACAAATTGTGACTCAGCTGCAATTACGGACAGGAGATGCCGACCCCATGATGACACGAACGAAAAAACAAGAGTGCCATTTCTTG
ATCGGGGAACTACGATACTTCCATCCAACAATATAGTAGCGCCCCAATCAAAGCCAGCGATTGGTATTTGAAACTCGTACTTCAGACCAGTCTGCGACTG
CTCGAAATACGAAATTGATATGTTATGCGCATACCCTGAAGTCCAGCCTGTCTTGAATAAAGTCAAATTGATGTCTCGAAACTTGAAAACGTCAAGTGAT
ATAGCTGCACTGCTGCCCATGGCAGAAAAAACACCTTGAATAAGTAAGTCGTTGGTATCACCAGGCTGCTTCGATAGAGGTGCGAGTACGTATGAAATTG
ATGACGGAAATAACGCGATTTGGCCAACACTACTTGGGGCATCTGGGCATCGGCTGATACTTCCAGCCTTGCAAACGCAACCAATAGCACAACGACCTGA
ACAAAGCGGATTGACTAGACCTACTTGGTCGCCGAATCGTGTGGGGGGGCATAGATACGTTGTGCCTCTCCTGCAGTAGTATCCTCTAGCACATGGCAAT
ATTGCGGATTGCTGCTCGTTCATCTTTGAACCAACGGAATAATAACCTGAAGGTACGATAGTTGGGCCAGAGTTTCCCTCCGGGCAGTACACGGCTCTAG
ATGGGCATGCAGCTAATGAGGTATAACCACAAGCAACGCCGCTGAAGGGACAGTAAAATCCTGGTGGTACCGCACTGCAATTTTGCTGGCCAGGCTTTGA
GAATGTTCCATTTGTGCAACGTGTGAGGTCACTACGTGACATCTGATCGTATGGACCTGCGTATCCCTCTGGAACATTTAAGCATTCGCTTGACCCGGGA
TCAGCAAACGTACCTGCTAGACATTTTACAGGTGCTGTTGATCTAGCTGCACATTTAAAACCGGCTGGGCACAAAAGACATGCTGACACACTTGATGCTC
CAACTAACGGGCCATACGTACCAGCTGAGCACGCACGACAAACCTGTGAATGTGGCTCAGAATATGTGCCCGCAGGACACTGCAAACACTCTCCAGTGTT
GGAGCTAACAGAGCCCGGGGTACATCTATCCGGTCGTAGCAAAAGTGTGGAGGAATCATAACCATCCACATTATCCCACACAATGCTTCCCGTCTTTTGG
CACCAGCTTTGCGCCCACGCAGCATAGGAAGCGCAAATTGGTAGTGGATCAAATGGTGCATTTAAATCCGATCTAGTGGAGCTGAGGCAATCAGCGTACC
AGAACCCACTTCGACTTTTCTTAGCGCAATTTTGAGTCGCAGACAAATCATTATCCTGATCTGGCGTGCTAAAATATGTATTCGAAAGGGAGCTTAGAGC
ATCGGTGGCAGAACTTGGTGTTGAAATGTATCCTCGCACTGTCAACAGATACTTCTCGTTCTCACTAGCAACGCGAAAGTCACTATAAGTCGCAGCCTGA
GACTGATAATCTTTTGAAATCACGAACATTGCCTCAGTAGCACGCGTTGTAATAGCTGCTAGGACGTTATTTCCAATCCACCATTCACTAAATGACCCCA
ATCCAAATCCATCGCGATAGTCGTTCCAATTACGATTGAAGCTTGTTTTACCATTGATGCGACGCTGTGCAACAATCCAGCCATCTGAGCAGGGGAGATA
CACAGAATCGACGCTTGGATCGAGCTGAATATAGTACTGACCGTCAGGATTCTGGTCTCCATTTGATAGTCGTTCATTTTTCAAATGCATGCACGACACT
GCTGGGTTTGTTATCGATAATCCTAGAGACGTTTTGAAGGAGGATTCCACCTCCATTGATACTTCGTCAATTCCAAACGCACTAATGTTCAAGGACCCAA
AATCAATTTCAAGCCGAAGCTGGGTGGCGTTTCCGCTGAAACCTCTCACCACGAAGTGCTCTCGTCCTCGGTAAAAATACGCTTGCCCGGTAGAAGTAGA
GCTTTGTCCGTAACATGCGTACATCACGGATGTATCAACTTGAATTTGTCGAACTAACTGAGAACCCAGTAGAACACGAATAGTCTTAGGTTCAAAACTT
TTGAGAAGAAGCGTGACCCAATAGAGGGGGTCAAATACAAAGTAGTATGTAAACTTGATGCGGATGTTCACAGGTTTGTCGCCCTTATTGATTTGGGTCG
TTGTTTTATTGACAAAAGAGCCAGGACGCGCAAATGACTTTCCTCCAAGAATCACGATTCCTTGGCAAAGTTGGTACCATTTATCTGTACTGCTCCACGA
CGTTAACCACAAATTGTCATCACCACTTCCAATAAACGAGTCTTGAAGAACAACGCTCCACGATGTAGAAGGGGTTATGTCGTTTGTCGAGCAAAGATAT
TTAGTCGTCGTCAAACCACGGGGGTCGAAACTTAAGCCCAGACCATCTAAGACACTTTGCCCATTGAAAGAAGCATGCATTCCGAGCCACTTTCTTTCAT
CTGGTGCATTTGCAGGAGAAACGACATCATAACTGCTTCCATTATCACGAAGCCACCACTTTCCTCCATCAATTGCTGCCCAGTCTAATACAGTATCTTC
GTCACTTGGCAAATCGACTGTATCCCCAACATAAGCATTCGTTACGCCAGGAACAGTAGAGAAGTATAAAGACCCATACTTGCGATGCATAGATACGAGA
TGGTCAGACGAGCGAGGCACAACCTGGCGGAGACCCATCACTTTACAAGTATCACTGTCTTTTGGACCCGTACTACTTCGGCAATCAATTTCGCTTGTAC
CAATATCACATGGAACGAACGTATAGCCTTCGCCACTATGAGCCGTCATATTGCAAAACACATCAAAAATCCCTGTCGTAGTAGCAATTGCATATCGGCC
ACTTGTTGCATTTGCCGCGTCGGACTTGATTGTGTGACAAGTCTGAGGCATATTCAGGTGAACAGTGCTTCCACCCCAGGTACCGTATGTCCCAGATTGT
ATATTTTGCCGCAAGTCCGTTGCTGTGATCCCAAAACACGCCCCATCTGTATTGATAAAGCCAACACAATTGCTGCTAAACTGGCAAAAACACCGACAGC
GATCTTTCAACGTGTACATTGCAGAGCACACACCGGTGCCACAAGAGTCGTCTTTGCATTGTGTTTGTACAGATACATTCTGATTAAGAGACCACTTCGT
GTTACGAAGAATTGTCCAACCGTTTTCTGAAATAACTGGTTCTTGATTTCGCACAAAACTGAGATGAGTTGAATCTGTTGTCAAAGATGTTGTGTTTCGA
AGCATAAAAAGGTTGCATGTGCTTGTCACGGTGTTGAATACACCTAATCGGCAAAGATTGTGTCGAGTACAACGTGATTGGCATAACTCTTGTGAGAGTA
ATGCACCTCTCTCGATGATGACAATTTGCAATTGAAGCCCCTTTAGTTGGAAGCCTGCACTTGTCAATGTTTTGGCATCAAGCGCAATTGTGTGTGATCC
AGCTACAGCATCCACGATACAATGCATTGTCAAAGGCTCGCAAGTTCCGTTTGCAGCTGACCCGGATATCGAAGAAAAATCTCCATCAAAAACTGGATCT
CCATTTTTTGAAAGTCGCGCACGAAATGTCTCAGTGGCCGAATTTCGGCAAATAACACCAGTAACGCGGATAACTAGAGTACTTGAGGTAGCAAGAGTTA
CTAATTTCGATAAAACTGTGGCCGCTAATGAAACCGTGCTGTCACCAATCGTATCTGACGTTAGTAAAGCCCCTGGAATGAAAATAGCCGTGGTTCTGCT
GCCAATGATCTTTCCCGTCTTCGTTCCTTGATACTGATAACTTAATGATAGATTTAATGCATTCGCGGTGGAGACCCTAGCAAAATACGTGAAATCGAGT
GGCACTCCCGACGAATCAGCGAACGTTTCATCTAAGCGAAATTGGGACGCCGGTGCAACAGCGTTTAATCCAAACCCGAGGTCGAGGCGAAATGTCTTTA
CCACGCTCTTGTCGACAAAAAACCTTCCCGTGAATGAGCAAAGCAAAACCCCGCTTGATGAATATGGGAGAGAAATGTTTAATCCAGGTATTGCACTCCA
TTGCGTAGTAACTGCTGTCGGGAACGTTACTTGAGTGGCTTTGGCATTGGCCCATGCGGTGGTCGGTAGAAATGAAAAAGAGACCAGCGATGACGTATTA
ACTTTGGTACTTTGCGCATCGGTTGTCGACACCGAGCCGATATGCACTGCGAACCGTCCATCAACTGGAGCATTTTGAAACTGTAAAACTGAAACTCCCC
TTCCGATACTGCTCGCTTTATTCGCCTGTTCAGTAGTGAGCGTTGTCGATATCGTAGAATCAGGAGCAACAAATGGTATCCATTTTGTTACCTCAGCTAC
AATGGCAGCAACAGAAGCAATAGTTGGTGTAGATCCTTCCCGACTGAAGTATACTCCCGCTGTTTCGAACTTGGTAGAAAGTCCGTAAATCTTTAGGACA
TGAAAACCAGGTGTGATTTTCATATCCACCTGGGTAGTCTTCGACAAAACACTTTTCCAGTATCCTGTTTTCCCCATCAAGTCTTGTGCAATTAGCCCAT
CGAGAACAACCACAGCACCGTTACCAAGTCGAAAAGGTAAACCTAGGTACCATGACCAACTTGTGGTGACTGGATTAGGCTCCACAAACTCCACCTGGAT
CAGAAATCCCACGTTGGTATCCACCTGCTTCGTCCTACCACATAGATCGCTTTGAGTGTTCAATAAACTCCCCACAGAAGACAGCTCCCGCTCGCAAAAC
CCGTCGCTTTCAACAGGTGCAGCAGCAGCGTCAAAGTCTTTTTGAAATGTTGCCCCTTGTCCAGCTTTGTATGTAGTTGCTGAAATAGGCTTAGATACAT
ATGACATCTTAGCGTATGGGCTGAGGGAAACTTCAATGGGGGAAAAGTCAGCTTGCCGCCTACAAAGTTACGATGGATCTGTAATGCCAACGTACTCGGA
TAGTTGAGTCTGGATTCAAGTACATTCTCCGTGTAATACCGCGAATCCTGCAATTGACAATGAGAGATTCAAGGTGACCAAATCGTTAGTCTTGATGTAT
TGTTGCCGTAGATCAGTATCAGTCTACCGTTCTGTAGTTCACATGGGCCACGAGCACTCCTGCACTTGGCGTCACTAGAGTCGCCGTTTTGTCGCCATCT
AGGTTGTCATACACAACCGACGGAAGAACTGCAACGCAATTGGAGCAGCAGTGTCAGACATGAAATCAAATCCAAGTAAAGGATCTCATTCACATACATG
GAATGAGCTCCACATTTGCATCCGTTGGTCGGGAGCCAGTGAAGGTGGTAAAGTTGGGTGGTGTCGAGGCTCCGGGTCGGTAGAGCAAAGCCCAACCTAC
GATTGTCCACGCGATCAGCTGGCGGAGAGGCATGGTGAGCTCGGGAGTTCACGTGAAGATATTGAAGGGACAAAGAGACTCTGGATCAAAGGTCGACAGA
TCTTGTAATTAATTTCACCTCGCTCTTTGTGAGTCTATTCATAGCCTCGCAAATTACTGTAGTGCTTGTGGGTACATTGCTGCGGCTCCTTCATGTAGAC
AAGTTATTGCTGACATTGATGTGAGAGGGTGGGTCAGTAGGTGGACGTTGCGAAGCGCTATCTGTTACCCGTGTGGAGAAGCGAGCAAGATAGAAAAACA
CATTTCCATGATTCATGCGGCAAGGACTGGTGTGAATGATGCAGCCAATCGGAGCTCCCTGATCTGATAGGGGCATTGTGATTAGCTGTGACGACGATGA
CCAGGCTAGAACGAGGTCGTCGTTGTGGTAAATGAAGTGCTCGCTTGATAAATGTCTAGATGTATTCGTACGTGTTCCTCAAAGGTATGTGTCAGCTTTT
GGCGTTAAAAATGTGTTTATACTTCGAATGTTATCCCTTGTCAGTATCAATGCATTGTATCGTGTATGCGCCTCGCTGGTGCGCTCTGTACGTATATCCA
CCACAAAAGTACCATGTACGAATAAATGGAGACAATAACGAATCTATCGATCAAGGTTTTAATTGTGTCATACATCTGCGATTCCCAGGCGCGCTCTATA
GACTCTCTTCACGTTTGCTGCAAGCTTACGAGTATGTCAGTCCCTGACCTCGACTAATCTGGAACGGGGTGTCTTCTGCCAACACTTGGTGCATTTGGCA
GTGGTTGCCCTTACGGACAGACCGACTGCAGTTCTCAGCCTCGCACCGCCGACCACCTCCGTGCGAAATGCAGTAGCCATTACCACGGTCTTTCTTCTTA
CAACCTTCCATGATGCAACGACGGATTCCACCGTGTAGGTAACACAAGCCAAGACGTTGTGTGCCTTTTGAGCAACCAGGGATGCGGCATTTCTTGCCAC
CGCCGTGAGCTCGACATAGGCCACCACCTTGCGAGCTCTTGTCACATCCCTGCACCTGGCATCGAGCACCACCGCCGTGTGTTTTGCACCGATTGTTTGA
TTGTGCGCGTCGTGTGCATCCTTCTGCTATGCATTGTTTTGCTCGTCGTGTCCCTTTCGATTTGGTTGACGAAGCAGATGACACAGTCGACGAAGTTGAA
GTGTTGGAGACTGTTCGTAATGTCGCTGGAGGAAGTGGCAAATTTGGTGCTGCGTACGGCATGTTCTTGCCTCCGAGTGGTGACGGATTGGGTAGTAGGT
AATTGAACAGCAGGGGATTCACTCGACCAGGGGTGGTTGAGATTGTAAGCGGGGTAGTCGGCTTAAAAGAGGGACGGCCAGATCTCGAACCTGGGCCGAC
AATGTCATCCCATGATTCACGAAGGAAAGAGTCCATAACTGGAGAAAAGTCAGGCATACCGCTCTCCTGCTTGATGTGCACGTCACCACCAACGGGAGTT
CTGCCACTAATGCGGATCTTGAGGTCGGGCGAAAGGCACGAGTTGCCGTCCATCGGAAACCCCGATCCACCAGCACTCATGGAATGTTGTGCACTAGTGG
CGAGAGGAGAACCCGTGTCGTGCGAGTTGAATGCGTCGCTTAATCCTGTCATGTTTAACTCCAGATTATCGGGGTCTTCTCTTCGAAATGCCGCGTTGTC
CAGCATCATCATTGTGCTTTCGAAGTCTTCATCATCCAGCAGAGGTAAACTCAGCATGTCGCCAATGTTGTACAACGACGCAGTGATAGGAGAAGCCCGT
GGATCCATGATTGCCGTTAGCTTCGAGGTTACCGCTCCAGATGATGTTCGGTATCGAGGCTGAGAAGCACGTGCGGTACAGAGCGAAATTGGATGTGAGG
GAGAAGCAAAGTGCAGCAGCGGCTCAAAAACGTTTAGCTCCAGTATGTTACACTGGGGTCGAGGAATGATTTGATTAAGGGTAGATCATATGAAGCTCTT
CATCGTTCCTCGTCCACCTTCCGGGCCTTATTAGTGATTCGGTTGAACTTTGACGGAAACCTACTGGTTGGATGAGATGGCGGGGGGGGGGATACACACC
ATTCTGTGTGACCTACAGCGTGATCTAGCTGACTGAGGAAGTATGCCGTTGGGATTTTCTGGGGCTATAGTTTGCTCGTGACGTCCAGCATGAACGTATA
CGACGGCACTGGTAGAGCGAGGGGCTCAAGGAGATCATTTCTGACTAACGTGCCCCACCCCATGTCTCCATCCTACCTGCGAAGCGAGCACTTTGACTTG
AATGTAGCTCGTGAACGAGGGGTGTTGATATGCATGCACGACGGTGTGTTAGCACTGGGCGTATCGCTCATTCGAAAATTACGATGTCTAGACAATGAAG
AACTGATTCAAGTGTATCACTGCGGACCCGATGAGCATCGCAAAATATCGAGGGATGTACTGTTCGAGATCGACAACCGACTGGAACTTGTCGACGTGTG
CTCAGATCTGGTACACCACGGTGTGATCAGCACGGAAGTGGCCGATAAATTCCGGAATTGGTGGGCTAAACCGCTGGCCATGTACCATACCGATGTCCAT
AGGATGAGATGTTAGCACTCACAAACTTTATTTAATAAAGGTAGTACTATCCAAGATTGATCGAACCTAGATAACAAGAGTCTGAATGAGCTCACTTTGG
GTTTTCTGTGCGCAGCCGTACATCATTTTGCCAAGGCCACTAAGGACCAAGTTTCTCGCGAAGTCAACATCTTCGGGTCGAGCGGATAGATTAGGCTGGG
TTTCTGCGTAAATGCGCAAATAGGTCCGCACAACTGAAGCATGTTGCGGGTCTGATTCAGATGCCGTAATGATTGTCCACGACGGCGATCTAAACTCTAG
TCCTTCTGTCGGTAAAATAATCGAATCAGCTTTGGCAATAACGATGCGCTCGGCCTCCTCGAACTTGCGAGAATAGTGGCTTCCATTGATCTCAAGGTGA
CTCTGCTGTCCACGCAGTATCATGACGAAGTTTTTTTCCAACGAGTTGGGTTTGCTTCCACGCAGCTATAAGCCCACATCGACGCGAAGGTTCACATTAG
TCACAGAAGTTCACACTATAGGCATGGGGTCTTACGTAGCGATAGCGCTTGTCAGGGATGTCGTGCACAGTCTTGAGGTCCTTCCACAACACTGCACATG
CTTCTTGGGTGGAGCACGAGACGGGAGTGACCGTCTCTATTTCTATAACCTTCCCGTGCTGTGTGAAGTGGTTGACGTTCATTTTGCAGGTGACCAAGCA
TGGGAGATCCCACCTAAAGCCGGCCCTCGACTCGATCAAGATGGCTTCCACGCGCTTCTCCAGTCTATTCATTATTCCTGCGCTGCTGTCTGGTGGGTGG
GGCTGGCGGTACAGCGGTCCTGGAGTACCGAACACGAGGTCCATTCCCTGGTCAAAGAGTGCATTAGTTAGTATCAGTAAAAACTAAATGATCCTCTTTA
CCATACCTCAAGAATGGTACGTCGCTGCAAAATTGCACGTAAAGCTTCCGCTGTGCGTTCCTGATTCGCTAAGATGACTCGTAGCTGCCGATTAGTTTTC
TCTGATTGCTGCCGGCGGACGAACTCAGTCACTGCTTGGTTGTAGCACTCAGATTTTGCGACCCCATTGGTTGCTGAACTACTCGCATCGGGATGAGGTC
CTGTTAATACAGTATACTTGGAACGCTTCAGTAGGTCAAGTTGCGCCTGCAGTACGAGTGCTTGTTCCACAAGCGCTATCTTTTCTGCCTTCTTGCGCTG
CAGCTGTCGAGTAGATGAGCTCGCAAAAGTCTTGATGCGCCTCTTCTTCGCTTTGACTTTAGTTTGGAATTGGTGCGTTTGTTTGGTAATCGTAGCGTTT
GTACGAGCTTCAGTGATGCCTACTCCGCATGCTTGCGTGATTGATTCCTCGCTGCAGCCCGAGCTTGACATGTCCGTCTTCTCCGTCCCGCAGGAGTCAA
TGAAGGCCAGAGCTTCCTCCACTATTGCCGGATCATCGTCTCCCACCAGGAAACTCATCCCAATGAAGCAGATTCTAAAATGAGTGAATAAAACTTCGTA
TGATTGCTGTGATTACTGAGGAGCCTATCCACGATGATGACGCTTACCTTTAAACAATAGCACGTATTATAGTAGTAGTAGTATTCAACTGTTGAATACC
AACAAGTAGACTTTATTGCTGCTTGGATAGGCGCTTGGTTGCGAGCCGCGAATCAAGTCTTCCCCATTTAAGCTCACATTTCAATTTGCTTTATACAAGC
TCAAGACACGTTCAACTTTATCGCAGTGCACGCAGAAGCATGTCCACTTTCACTAAGTATGCGATCGTCGGTGCTGGAGGAGTCGGCTCTGGTGTTGTTG
AAGGTCTTCTCAAGGCCAAGGCCACTGTAACAATCTTGACGCGCGATGATACGAAGGTAGACGATTTAGATGTGAATTTGCATGTATGCGCTATATTCGA
AAGTCCTGACTGTGATGCCCGCTGTCCCATCTAGGCTGAACTCCAATCGTTCCAGGAGCGTGGGGTATCTCTCGCGAAAGTGAGCAACGAAGACGAAACA
TCGTTGGCATCAGCTCTGAGTGGCTACGAAGTCGTGTAACTACTATTTGATATCCATTGGAGTTAATGAGTGTTTCTAAGTGTTCCACTTGTTTTATTCT
AGCGTGTGCGCGATTCATGCGTATCAGCACGCCGTCCAATTTGCCATTGCTCGCGCGGCTAAGGCAGCTGGTGTTCAACTCTTCGTTCCTACTGAGGTAA
ATACCTCCCTTTATCGGCCTCTCGATACACTCACGCAAAGGCCCTACTAACATGTGTGCCGATTCACTAGTTCGGGATGCCTGAAGAAGATGGACCGAAT
GTCACGAAGCAGAAGGTCCGTGACCTACTGAAAGAGTTAAACCTCCCTTTCGCACTCTTCCACGGTGGGCTGTGGGCCGAGTACATTCCATTGTGAGTTA
ATGTGCAAGTTGAGAACAAAGGTGGTCATCAACACTAATCTGCTGGTGGTTTTGTTTAGCTTCCTGGGCTACAATTTTAAGGAAGGCGTCATGAACATTG
TCGGTGAAGGTGATACAAAGATGAGTATCGTGGCCAGGTCAGACCTAAGTCGTTTCATCGCACACGTGCTGATAACGACACCCAAGAGGTCGTTGGAGTG
GTCCCGATTCTCTGTTGAGAGTGATCGCATGTCCCCGAAAGAGATTGCGGCGCTTGCTGAGAAGAAGTTGGACAAGAAGATGGAGCTCAATCTTGTGGGC
TACGACGAAACTAAGAAAAATTACGAGACGGACCCTGTGGCGTACATTCTGACACGCATTGCTGATGGAAGCTGTGTGTCTGGGACTGTAGAGGAAGCCA
AGGCCACAGCCAAGTACTTCCCCGACTGGAACCCGACATCTTACGAGGTATTCATTGCGTAGTTGCGAACCTTGTCGAGTCTTCCACGTAGGACACACGC
AGCTACAACACCCCAGCGCGACATCTCTTTGTAACGAAAATTGAAACAACGCGTTAGTTGGAATACACGCCTTTTGTCTCAATTTGGTTGTACTTCTAAT
ATATATCGCATTGTTACCGATGCCTCAACCTTGACGAGCAATTCATGCAGTGTAAGTTTCTTTGTACTCGATGACAGTTCAGGTAACACCACTTCTGTGA
GATTGATTGTATGGTATTCGTAGAGAGCGAAGACGCAATTGGGGCGCCGGCAGGACTCCCGGAAAGTTTACACGAGTGTATTAGCAAGTGAAATACGAAG
TGAGTGAACTACTGCCAGAACTCCACCTTCTGTGCCAGTAATGGAGACGTAGCTCTAGTAATCTACTAGCAAGACTGTACGGCACACGGCGTGAGATGCC
AGTCGTCAGCCACCAGTAAAGAAGATGCAAAAGCAAGTTGAAGTCGAGCTGCCTTTGGGCAACGGCGCTCGCGTCCCTATTTACCTTTCTCATAGTTTAT
CCTTTATAACGTAGTCTAAACCAACTAATAGTCAGTCTTCATTTATCCTCGGAACTGGCAGATCCCTCTGCAAGCCACGGACTACCAGAACTCTTCGTAG
ACCCCTCTGCGAGCCAAGGGTTGTCACTACGCTGTCCTTTTGTGGTTACATACAAGTCCAGCTCTTGGGTACACCCTTCTAAAGTGCATAACTTCAGGAA
TCCACTTGGATTCTGGATAATTTCGTGAGCTTCTGATTGACCAGAGGCTTTTGGTATAGTGTACCACTTTATGATTCCGCTTTCTGAGAATTCCTTTTTT
CAGAATTTTATTCTAAAGAATGTGACGGGGTCACACGAGCACCTTGCTTTGAGGAAGCGTGCTTTAGGAGTATATAAACTCGCGGTGAACAACCTTTCAC
GGTCTCCGGCCTAAAGATTCTTACCAACAGAAGGTAGGTTAAAAGACTGAGCATATTTATGGGTAGTCCTAGTTTGATCTGCACACAAACAATACGGTAC
CTATAGTAGAACCGATATAAAATTAATTGATTCATGATTGAGTGGCTCTCAGCCACTGGTGGCATCCTAGCACTACGGTTCTCTACCCTCACAGGTGATT
TGGGACATCGCCATTGCGTCCCCACAGTCTCCACATCAACCCGAGGACATGCCTCGAACAGGAAGCTCGAGTGGTAGCGTTGCAAAAAGCCCTTTGCAGT
TTTAAATATGGGCGGGTTTGAGTTTTTTAATCGCATGTTGATTGTCGTCCAGTGAATCAATGGCTGGCATTAGTCAGCGTTTTTGTTTGCCAGTGTAGTT
CTAACCACTAGTGCTTTTGCATTAGTTCACTGAATCCACCAAGTTCTCCCCCTCCCTACCGTTGTTACGCGATGAGTTCTCCGCTTCCAATCCTCCTCCC
GACGACTACGTCTGACATCATCACGCCCCCCTCTGCCAGCTAAGCATAAGCTTGACCCTGTATGGGCTCATGTTGATATTGACCCAGAAGGATGTGTGTG
GTGCAAAAAGTGCAGCAAGCTTATCCAGACAACAGACTGGACTCGCGCCCAGCGTGTGAAGCACCATCTGGTAAAGAAATGTGCCGGCAGGGCGTCAACT
CCGCTGATTACAGACATGCTTCGGCCGAAGATAAAGGCCGTTGTCCTGAAGAAGTTCCAGGAGAAGCTTGCTGTGTGAATGTACAGTTCGGGGCTGGTTT
TCTACAAAGTTGAGCGCGAGAGCCTCCTTGAAGCACTTCAAGTGTTAACACCGGGAATTAAGGTGCCCACCCGAGACCAACTGTCGAATGCGCTGCTGGA
CAGTACGTACGACAAATCGATCATGACAGCCACGCTGGAAGAGAAAGTGGTCACGATCTCTTCTGATGGCTGGACCGATGTCTGTGGGCGTGCAGTGATC
AACTACATGGCTGTGTGCGGGAAGCTGTGCTATTTTTTGTAGTCTGTATATACTGGTGACCAGGCTCATGGGTTGAGACTCTGATATTCGGTTATAGACT
GGAATAGCCCAAACAACGGTAACGTTGCTTTAACCTCCCACTTAGACGTGCTGCGATACACGACCACACCCGAAGCATGGCATGCACCCTGAGCTCAGGT
AGGCAGGAGGAACTTAGCCCATTATAGCGCGAAAGCATTGGTCGCAACCCAATACGACTGCCAACCTTCTGCCACACAAATGTGTTTGGACTGGACTGAC
CCCCTGCAGGGTTTCAGCGAACCGCAAAATCGAGAGTGAGCAGCAAAGCCCACTCGGCACAAAGTTTGTAGTCAGATGCCATTTGATTTTAGCTGTACGG
TTTTGAGAAGTTAACATTTGAAAATTTGTAAAACACACGTTTGCATAAGATTTTGGATAAGATTATTGTGGATGGTTGAGTGTTTTTTAAATAACCCTAA
AAATCCCGACCCTGATCTTTGGATGGGGTGGAGGGATTAATGGCTTCTTCCCAAACTAAAAAAACGTCCGCAACCCTATCGAGTGGTGACTCTGCTCCCA
TCATGACTAAGGCTGCAAAACCAAAGTCCAATCTAGCTAAGCCTCGCAGCGAAGCTAAGGAATCATACGATGCAGTTGCGAATGCAAATTAGGTGCATGA
TGCACCTAATGCGGCAGTGAGCTCGAGCTCGTCCAGCAGACGGTATTCGTTGCTGCCATTGGACCATGACGAAAACCTTTGGTTTCTAGGTCCACAAGTA
GGTCTCTAGTCAATATGATTGACGAGACCATTATCATCTACTCTGGCAACGGGGGTGAGGACTAGGACGCCTTATCCAAGTCCGCAACCGACAATTCAGT
CATGAACACCTGTACTGCAGGTGCCAGTGACTCCCTCGGCGACGGGGGGTGGGTTATGGAAGCTAGCGCCAAGAAGCGCAACACATCACTTTTTTCCACA
CGAACGACCAAGACCTTGGTGAGGTCAATGGACACGGCACCCAGCGCAGGGGCTTGTCTAAGTGTGGAGGTGGTCTCATCGACTCCAGTTCCGAGAAGGA
AGGAACAGTCGAAGGACCTTCAGAGGTTGTGAGCAACTTCGACGAGCAGCAAGATGCATTGATTGCTGCTCATTTGGCTTGACAGCCACTTCCCTCGGAG
TCTGCTCACACTGAGCACCGGGTTCTGGCTCAAGCTCCAAGGTATTTTCGACCTGATGAGGGGATAGGCTCTCCGTTGTTCCTCTAGCAGCTCACAGACC
CTCGTGTGTTTCATATCCAAGGGATCGTACGAGCGCCATCTTGTAAAGGATGTGCCTCGTTGAGAATATAGAGGCCGCCAGGGGCGTGCTTCTTGCGCCG
CACAGAATTTCACTGAAGGAATTACCAAATCTTTGTAAGAAGCCTGAGACAAAGGGTGGTCTCCACCCCGTGTGGGGTTTCCCATAGGTGCAATTGGGGA
ATATCTCCAAGGCTGCACAGGCCGAAGCCTTGTTTTGGAGATGAGTTATCGTCAAGGTTGTCCCATCAAGGAGACCCAGGCTGAAGCTGAGCTGGACCTC
GTCTTGCTGCAGTGGAATCTTCGGGTCTTTGAAACATCTAGCAATTTAGCTTAGAACACGACCCAATTTCGTCAAGAAGTAATTGGAGTGGCTCAACAAA
GCATGCGACTAGCTCAAGATCATCAAGCCTGTTGCTTCAACCGTGGACGACAGCAAGTGAAGGTGGCTTGGTTTACGTGGACTCGCGCGTTCTGAGCAGT
GAGCTTTGTCAACCAGATTACGACCCCGAGGGTGATCCCACCTGCAACAAACTATTGACCACATGGTACGACCCGCATCCCGCCGAACAACTAATTTGTG
AAAATGCATATCGAGCTACTCTACCACGTCGTTATCTGTCACGAGAACGTCACGCCACGTTCAACGTGGATCACTGAAGCGTTCGCTGGACGTCCCAGAG
ATTTTCCGGGGTCGTCAGATCACGAAGAATGCGCCTCGAATGTATGACGAAAGAGGCAAGAGAGTGTATGTGATTCGAGCTTTGCTGAACCAGCGCCGCC
GAGGTGGGCGAAAGCAGTGCCTCTGATCCTCGGTGGACCTGCCTGAAAGCGAGAACTCTTGGGAGTTTGAAGACGGCTTCAACCACGTGAGTCACTGGGG
TGCACTACTGAACGAGCTTGCGCCATACTTCGAGCAGAAGAACATGGTGATACCTGATATCTTTGTGAGCGACGAAATGCGTGATATGTGAAGCGAGCAA
AGTGTAAGTAGTACGTGCAAGATGGTATATCCACTCGGCTAGTTGAATGATTAAACGCCAATGCCGTGTTCATCCCTCAACATTTAGCGACCATCTTTTA
TAGGTATGATTACGCCATAAGTCCAAAAGTTGCCGAGAGTAATATTTCATTGGCTCTTTTGTTGCCAAGGGAAGACGGTTCCATTGACGGATAATAAGTT
GGTATGGTCAGCACAATGTGTGGGGCTATACTTCGCAAAAGTCAAAGTTCAAAGGTGGTCAAGAAAAGTTTGAAGTACAAGAATATACGGTTTGATTTGA
GAAAACATCGACGACGTATTTATCTAGTGACAAATGTAGGAGTGAGAAATGAAATAGAAAATGAATGAAAGCTGTAGAAATTAAACCGATGGGGCGGGAT
AGCGTGTGGGAGCAGTGATAAGAATGGTTTAGATAAGAGAAATTAGAAAGATACTGAAAGAAAATTGATATAAATTATTGAATTTATTGAGATTTGAGTG
AAAGATGAATAAGGAAGTTAAAGGTGAGAGTAGAGGAAAGAATACAGAGAAATCGTTGTATTAGGGACAGTAACTATAGAGGTTATATATGTAGAGGTTT
ACGGCAGGGGTATGTGTGTGCGAGGAGGGGTGTATGTGATGTGATATTTTTATTAGAAAAAGTGTAAGCATCGGTAGGTGGGGATATAAAGTGAATGTGA
GAGGTTTGGTTAGTATAGAGGTTGTGTTTTTAAATTGTTGTGATTTGAGAAGGAATTGTGAAGAGTGTGAGAGGGTAGAAAAAAGATTGTTTGAAAGGAT
AGGGGTTGTAGTTGGAGAGTAAAGGAATATGTATTTTATAAGAATTAAGTAATAAGGGGTGTGATTGAAAGTTAAAGAAAAGGGGAAATTATAAATTAAG
TTGGATTAGATTAGCGTTAAGATGGAGAAGTGAAGGT