Description :
From Genome Similarity Track
Location :
contig_156:34971- 35977
Transcript NameFunction/comments
g13885.t1hypothetical protein

Sequence
1006 bases(100 bases per row)
CCACAGCACGAGCGATCAAGCCGCCCATCGAATGTCCCATGAAGACGTAGCCGTCGGCAAACCTCACGTCACTGGCCACCACACGTCGAATCTCGGCGAT
TGCCATCGGGATCTGGTCTTTTATTCCCCCGAGAGAGTCTTCACCTTCGGCGAACGTCAGCGCGACAAAGGCACGTCCTTCAGCCAAGACCTTGGCCTTG
ATATTGCAGCCGTCCTTGCTACTGGCAGTCAAGCCATGAAAGAAAAACACTGGAAGGCGCTTCTTTTCATTGCTCGTATTGGCCTGGTTAAGTTGTTGCA
GTGGGTCAGCATTAATTTCGGACGGTCGACATAGATGCAAACAACTTACCGAGGTCATTGCTTTTGCTTCCTGTGGTCGATACCAGCTACTTGATGCAAT
TACTTGTGTGGATCTGCTTTCGCACTAGAGGTCGGGGACTCGGCGAAAATGGGTTCGTAATCAGCAGTGAGGTTCGTAAGCATTTTTGTAGAGCTGAAAT
CTGTTTTCAGGATGCGGGTCTCTATAATACGTGTGGACAAGAACGCGAGAACAGGGTAAGTCTACACGGCCAAACAAGCATCCACCACCCCGTCAAGTCT
GCCATCGGCGTCTTGTTTCTCAACCAACGAGCCTCACGTCTTTGGTATCTCAAACGACAAAACGAAAGGTGTGTTTCTGAGCTTATGGGAGTCTAAAAGT
CAAAAAGCTCCGTGTGGACATCGAAGCTGATGTTCATGTCCTTCGAGAGTGTGAGGCCCGTGGTGACAATGCCATCCACGAGAGGCTTCGGGCCACAAAC
CAGAACCGCCACTCGTGAGCTCCCACTGGCCTGGGCCTTTTCGCCCATAGCTCGCAGAATCTTGGCCGTGTCCGGTCGAGAGCCGTAGCGGAGGCAGTTG
CTGAGCTGATGGTCCAGTTGAGCCTCGACGTCCCTCTCACCCCGAGTCAGGTAAAATTCGCTGTAGAACGTGCTCGTCGGGGTATTTAACGTGGTTGGGT
CCTGAA