Description :
From Genome Similarity Track
Location :
Scaffold_70:34965- 41118
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_70-fgenesh-gene-0.18L antigen family, member 3 isoform 1

Sequence
6153 bases(100 bases per row)
ATCCAAATGTAAACAGTGACAGCGATCTGTTCACGAAGTCCTGCGCGGCACTATGCAAGCATCCCTCATCAACGAACCACACAACTGAGGAGCGCTTGCT
CAGGAGCGTGTAGAAATGGCTACCGCTACACAGATCGGACAAACTGGTCAGTTCGTAGGTAAACAGTGGTTGGCTGGAATAAAATGAACCCAGACCCTCT
AACCGCAGCATATCCTGCAAGTGTACCCGCAGCCATGGCCCAAAAGAGCCAGAGGTGCAATTCTGCTCGTTGCACCAAGCCAAGGATCTCTGAGCAATGG
CGAACAGTAAACCGCGAACCTTGGATTGTGTAGGTAACATTTATGTGAAACTTTGTAATAGCTCACTACGTCTTGATCGTCTGTGATGCAGACCATCACT
GCCAACGAATGCGAATCATTGACATCGATGGATGGGCTCCGGATATAACAGAAACCGACTCCACATGTTGAACTGACAATCAAATCACATTCGTCTTCAC
TCGCCGGGAAGGAGATCAGCTCACTTGAACTGGCTGCACAACCAACCTGTGCCGTGGGCTCCGTTGATGCCGGTCCAGCATGTCAACCCACAAGTTCGCG
TCGTCATCGTGAAGAATACTGATGTTGTGGTAATGAGGTCGCAACACATTTAGGCGCATCCTCAGTTCGCTCGCATGGGGAAGATCGCATCCAGGAGCGA
TGCCGCTAGCTCGCTGACGGCATTTGGCATGCCTGAATCGCGTAGTCTCGCGAGGCAGCTGCACCATTTGCAAAACACAGCGGACATTCAAATCAGTTGC
TCTGCATCAGGACGGAATATCCAGCTACTGCCGATACATACCCGTTCAGCTGGTCGAATTCGAGAGATGGAAGCGATGAGATCAGCTGTGGTATGCGTCC
CACGAGCGCACCAACTACTTTCAAGCCGCTCATGGCAACCTGCGCGAGCAGACGACGAAGACAGCGTGTAACCAAGCGCCATCAGTCTCTGTCGCCAAGG
TGGGCTCGAACAGCTAGCTAACGCACCTTGTCGCTCGCTGTTGAGGTGAGCAAATAGCTAGTCACAGTGAAGCACTCGCGTGCAACCTCGTGGTTGGCCA
CATCCTTCTCGGATGCTGCGAATTGGTAGAGATACATGAAGACGAGCTGTTCGACGAATGTAGCAGATCGATCAGTTGATTGTCAAATATGATGAGGCGG
ATGTGAAGCATACCTCAAGTCCGCCAGCAACAATCTCATTTTGCTCGCAAGCTGGAATTGCTGCAAGGGTGTCGCGGACGATAGAGTGGAACGGGAAGCG
CGAGGCTTTTTGCGCATCGAGCTTGCGAAGCACGCTGTCGGGTAACAGTGTCAGCTGCCATAGCTGGTGTCAATTGTACAGATACCAAGAATGAGCTCAC
CTGATCATGATGTTGCAACAACAGAGCCGGAACTGGAGCTGCACGTCTTGCACATCACTGGCTTTCCGCACCGAAACTTGATCCATTCGCTGTCGCGTCA
GGTGGGCGATGCCAGAAGTGTTCTTCTCCTCTCCAGGCTCACCCTTGTCCCATATCCAGCTCATCAACAGATCGAGCAGACCTGTTCGTATTTCAACCAG
GTCGTCGATTTCGCCGGAGATCGCGCTGGTAGACGCGATGAATTGAGCGATCCAGTCGATGCAGCCCATCTGAAGATCGGTGATTAACGACATGCTGGGC
TGGTTCGGATCGTTATCGTAGCTCGGGATCTGCAGCAGCAAGAACAAAATAGCGAGGATCGAGGCTACCGTCCCTTGGCCGTCACTTGGCAGCGAACCTT
CGTTGACGACTCGGTTGAGATAATACACCATCAGCTTGGCTGCAACCAGACCGCACGACTGTTTCGGGATTGTGTCTGTCCAGCTGACTGCAGTCGGAAA
CACCGTTCCTGGGAGCTCGTCTCGAAGGAACGCGATCAAATGCGCCAGCACAAACGGGAGTACTTTCTCGGTCGGGAACTTGGCAAGAATCTCGACAGAC
AGCATCTTGACTTCCTTGAATTCGAGTGGGTTGACCACCTGCAGCGCTGTGACGTGGAACAACTGCTTGAGGAGTTGTCCATTATCATCGCTTTCTTCTA
GCGGGTTCGTAACTTGCTGGCCACCACAATGTCGTTGGTACTGCGTCAAATGAAGCAAGTCTTCTCCATCTGTGCAGTTACACTGAAGCACAACGAATTG
TCAGTGTGGGTCTGAACGACTTCACAGGCAGACAGACGGCAAACCCGGACTCACCACCAGCGGCTCCGAAGTCGCTGCAACAAATTGTTCGCGAGGGAGC
ACCCGCAGTACCAACACGGGTGCAAGGCGGGCGAACAGCAGAGCCTCGACAGCGAGACTAGAAGATGCCGAACTGTCCTCGAGTAGATCTTCGTGCAACT
GCTGCTGGCTCTGAGATACACAGCATTCACGGCGTCAGCATTTATCATTCGTTTACAGCGTGATTCTCCGGATGCTCGATCTCACCATCATGTGTGTGAC
GAGCTGCTTGACGAAACCACTGAAGACTACCCCCTCGATCCAGCCCGCAGCCGCAAAGCCTCGCAATATTTTGAATAGGACCGGATCCCGAGGTGATCCC
AAAATCTTCCGGAGCACCACTTGAACGATCGACGAACGTGATTGTTGACTGGCGGCATGACCACACCATCTACAGCAATCGGAAAGCAGCGTTAGCACAG
ATGTTTGGATACCGGCTAGTAGTCACAGAATTGATGAAAACTGAGAAATGACTGGTCCAACCAAACCCACCCTTGTGAATCGAAACAAAGTTCTAGGACA
CGCTCTTGGTCATCTGACAAAACATCGCCGCGCGGAGGTGCCTTGAGTTGAGTATAATCGGACCAAAACGTCCCTGGTGATGAGCTCAAGCTTTCGGCGA
AGGTATTTGTGTTAATGCTGATGGTTCGGTGTCCAAATTGACAAACGGCAACAAACGTAGACACCATATCATCAAGCTCTTGTCCAGATGCGTTCGCAAA
CAGATAACCCAAGACAGGTATTGCCGTGTGTTTGTCAACTTGCGTAGTCAGCAAGTGTCGAACACAGATGGCTGGATCTAACATCGGAAGGCACGAAATG
GCCTGTCAAGTCGTTTGAAAGCACAGCAGACAGATCACAAACTATAAGCGACAAAGCGAACGATGAATATACCAAGTCAAGCAGTGCAACGTACCAGGCG
TCGACAAACTGGATCAGCGTCATCGATGAACGCCAGAATCCTTGGAGTGAACAATCCTCTACATGGCACAAACAAGTTCCAGTGAGCCGATCGTGCGAGT
GGTGCATACGCTAATGCATGATACCGAATCCTACGGCCAGATCGCCCACCTCCATCGAGCTCTGTCATTGTTGGAGCTTTGCTCGTTCAACCGACGAAGA
ATCGCTCGCATCACCGATATCTTCAACAGGGGATTATGTTACACAACACGACTCGACAGTGTGTAGGGTGACAATTGAAGTCGTACCTGGGTTTTGGGGA
ATAAAGATGTGGACTCCAGTACCAGCTCTATCGACAAGCCTCTCGATAGCAACAAGTCTGCGAGAATCCACTCCACCAGGAGTCTTGCCGATGACTCATC
ATCGCTCTCCGAACTAGAATGCCCAAGACCACAGAGATGACTCCCCAAGCATCCCAGAAGTTCAGACACCACAGCTTGTGCATCCTCCTTGGTAGCGAGA
AAGTCGAGATCAGGAAATTGATCAATGAGTGCCCAACGAAGTGCCATGATGCACATTTCCACCGCATTGTAGGCTCGATGCTGTATCGCAACGACCAGAC
CGCGGAGCCACAGCACAATGTACGTTCTTCTCGTCAAAACGTCGCCAAATACCGACTGCGAGAGCTTCGGCGAGCCACGAATCAAGTCCATCAGTACAGA
CACTTGACGCAGTCGGGCAAACTCAGTATCGATATCGACCGGGTCTCGATTCGTTACAGTCAGACTCGTCAATATTCGTGTGAGAACCTTGGCTGGTCCC
TGCTGTCGGATGTTGAGAACACTTTCGTTGCGCGAACACAGCAGCGATGCGGTTGCTTGCCAATGCCAAACTGCCAGTTGCACGGCTGCACATTCCGTAT
CGCGCAAGCGCTTGTCACTGGCGGCAGTCGCACTGGTGTCGATCAGATTCGTCAGTCCCACCAGAATCCCTCTCAATTGGTTCACGGCAGCTGCAAGAAA
GCGTCGCCGCTGAGACTGTCGATGCCATTCATGAAGAGTAGCTAGAGCATGGCACATTGATTCCTGCAACACATCAGCTGATTATGTGAGGCTCCACCTC
GCATCCATGGATCAACAATCGAACATACGTACCAGTATTGTGCGTACATCTGACGAGGGTTCGAGGTTTCCATGTGGCATCGTGAACCACGAACTCGCAT
CGCTGCACACAGCGATGAGCGTTTCCAGCGCAGCGAGCCCGAGTTTTGTCGGCTTTCTGACGGAATCTGCATTCGGCAAGCGATTAGCCGACAAACAAGG
TTTCAGCGCATGTAACGACAGCAGCTTACCGTTAGTAGCGACATATCCTTGATCAATGACAGTTTGCAGTGCTCGAGTATAGGATACAGCAAGAGTTCGA
CTCAACAGAGGCATCGATGACTGTCTGGCAGACAATCGGAAACTGGATCGACGGAGCTGAAGCAGCTCGAACAAAGTAAAGCACGCGATGAGCTGGCGGG
ATTTGTCAGCCGCGTCCTCGAGCCACTGCAACAGCAAATGCAGGAAGAAATATTGCGCAGGGCCATCGTCGTCGGTGCTACCGGACTTAGTGCTTGGATT
GGTCTCAAGGCATGCGATCCAATACAAGAGTGCGTGGAATTTGCGCGACTCCTGGGACCACACGCAACTGTTGTCTTTCGTCGAGCGGCACTTGTAAGTG
GACTGCATCATCAGCGTGCTCGACACTGTCACCACCAGGTTCCTGTCCATTACGATATCATGGTCAGAGAACTCCCGTCGATAGCTTTTCGGCGCAATCG
ATTCGTCACCTCCCGCTTTCCGAAGAGAGGTGTGGATTGCGTGGGGACGCGTACGCTCGCTCAATCGTGCTCTGTGAGTCCGAACAATAACACAGGTGAG
AACCAGACAGTCAACGCGTCTCAGCTAGGGCGCCGCTCACCAAGAGAGTCTTGAGATTTGCAATCAGCTTGTGGTCGGAGAGCGAGAGTGCACGAATCTG
AATGCAAAGCATCACGCGGTTAGCTTCTCAATTTTGAGAGCCTTCACGGTTGTTGTTCGAGTAACTCGTGCAGGTTCATTACCTGAGCGCTGCTCGCATC
AGCCTTTCTGCCATCCAAATGGTCTCCAATAACAATGCCGTTGTCCGAGAGCGATCGGTCGACGCCGTCAAGCCTGTGGGCTGCGTCAAACGCCTCGATC
GCTCGTTCCACCTGCACGCGAGCAGCAAGAACATGAAATTGTCAGGCTTCAGCAAAGCCCTTCATTCTCTCGAGCTCCAGACACCAACACCGCGGTGTAG
CGAATGCAAGCGTACGTACGTGAAAGAGCTCGCAGTCGCGCACGTGGCGCAGCAGGCGTCCGACGACGCGCTCCTCGCCTGCTGGTGCTGCCATCTCCCC
AGCTTGTCAAAGTGCGCTGCTCGAATGCAAGTGCTCCAAATACAGGACCTCCATCTATTGCCAGTGTATCATAGCAGCCACAAGGAGCTTGCCTCACTCC
AGCATTGAGGCCACGGGATGGCGATATGCAGGAGCTGATTCGTTTGTTTGCACTGTATAAGCAGCGAGGTGACTAGTTGTGGCGCTGGACGACCAATTAC
CGGTCGATACATGGTCGCAAAGACCAGAAGGATAAACACAATGACGATCACGGATGGATGTGTAAACGAATAACATGCACTAGTCGCTCATGCGCGATTG
TGCTAGATTACTCCTTAAACTCGAGGAGAGTGCGCGCGATGAGGACGCCCATGTCGTAGAAAGAGGACACCGCTGCGCGGAGCAGGCGGATCTCGGTCGC
TTCGAAGTGCCTGCAACCACACCGACGCATCGCAGTGCGATTCATTAGTGATATCCTATCCTCATCTGCCAGAATGCCGCACGAAACAAGGATACATACA
CGCGCAGCTCATTGCCCTCGACGGACAGGGAGCGGTGGATTTTCTCGGGCTGG