Description :
From Genome Similarity Track
Location :
Scaffold_4:349634- 357402
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002060Similar to UPF0563 protein C17orf95 homolog (Xenopus laevis)
Pytul_DAOMBR144PYU1_G002059Similar to SPBC776.07: Mitochondrial acidic protein mam33 (Schizosaccharomyces pombe)
Pytul_DAOMBR144PYU1_G002058Similar to SGT2: Small glutamine-rich tetratricopeptide repeat-containing protein 2 (Saccharomyces cerevisiae)
Pytul_DAOMBR144PYU1_G002057Similar to SRP40: Suppressor protein SRP40 (Saccharomyces cerevisiae)

Sequence
7768 bases(100 bases per row)
GTAGTGACAGCGCGCCACGACAGAAGCGGCAGCGCACAGCAGCCACAGACTCAACAGCTTATGGGGTCGCGACGGTGCAGATGGTGGAGCTCATCCAAGA
CCTCCACGACATCGAATCCCATGACGACACAACGCACTATGGGCTCTTCATTTGGCCCTCGGCGATGGTGTTGGCGTACTTTGTCGCTCGTCATCGCACA
CGCATCGCGACCAACAAGGTGGTGATGGAGATCGGCTGTGGCACGGGACTGCCCGGGATCCTTGCGGCCATTTGCGGCAAGCCCAAGGCGGTAAGTACAA
ACTCCTGCTGTACGCGTTCATGGACTTGTTGAGAGTAACTGTGGGGGTTGACTTCCGTGGATGGCCTTTGCTTGTGCAGGTGTATCTGACTGATCGCTCG
GATGCGATCGACATCCAACGCAACGTGGAAGTCAACATTCGGATCAACGGCATTCAGGACGTCGCCAGCTTCCTCCCACTGGACTGGGGCCAAGTAACGG
GGAATGAGCACTTGCTCGACTTGTTTCGGACGGTGGATGTGCTCCTAGCAGCAGATTGCTTCTATCGGTCGGAAGGTAACGATCCAGACTATAAAGAGGT
ACAAATGTTCACATCTCATAGCAGTTGTACACGTTATCTTTACGCAAAGATTTCGAGAACGTGATTGCGACCGTCGCATTCATCTTTCGCTGCAGCCCAA
AGTGCAAACTCTACACCACATATCAGCTTCGAAGGTATGTGCCCATGTCTGCATGCCGTAATCAGATCATCAACACCTGCAATGCTTAACATGTGCCACT
TGTCTACATATGTGCGTCAGCATCACTCGGTCTATTGCGCCGCTGCTTGCTCGCTGGGGCATGGAGGCCAGAGCCGTCGATACTGCGCCGTTCCTTCCAA
CTGCTGACGCAAAAGCTGGCAGCACCGACAACGATCCACCCTACGAAGGCATCTATCTGTACGAGATCTCGTCTTCAAGACACCACCCAGACAAGTGAAT
AAACTCGCTGTGTGGAATATATAGACGCAAAGCAATGCAATAGATGAATGGCTCAGATTCGCCTTTTCTTTCTCTTCTCTCATATCGGAAGCAACCCATA
TACACATACACAATGATGTCTCTTTTCAGCCTGCCGTCAAGTCGTCCACAGTAGCTTCTCATGGACAGACTGGCAGCAGAAAGCCACTTTTTTTTTATAT
AATCCTTCTTTTGTATCAACGCACATATATCAATGCGTCGATCAAAGGGAAGAGAAGCACCACGTGAAAAAGTAAAAGACGACGATGGTCTTCAGCGTCT
CTCCTCTGTGGGCTCATGAGTTCCCCATACAGCAGCAAAGGATACAGAAAATATTCCCAATCGAGAAGCCAGTAAAGTTGTCTTCCTCGCCATCCATACC
GTCCAGTTGCACCGCAGCGCGCACTTTATACACGCACACAGCAGCGCATGCATGTGGACCACATGCATGTACATGTATAGACACATAAGTAGATAGATAT
ACATAGAGCGACTGCCGCCCACCGCCAGCGTCATCGCGTCCATTTTGCTGCTCCATACTTCTTCGCATTGACTTTTTCTGTGCATGGCCTCTTCAATCAA
AAACCTCGTTTTCGAGGTTATTTACACCAAAGATTCGAGAAACTCGGATTCGACGCAAGTTTTCAGCCAATCATCTCGCGTATACGCACACTCTTTTATC
CAATGAGGGAGGCGAGTTTATGTGGCCCATGTGATCTTGCGGCAGATTGAACCTTTTGGCATTCCACATTCTGCCGAACAGCTCCGTCCGCATCGTACAG
CTCATCTTCCAGCATGCTCGCCCGTGTCGCCCGCGCCGCGTCGGTCTCCATGGCTAAGCGCACCTCTGTCGCCGCGCCAGCGCTCGGCGCCTTCCAGCTG
CGCGAAAAGTCTTCGCTCACGTCGCTTCTCAAGGTGCGATAGCGCTTCTGAATGATGCGATCGTCACTGCCGTGACTTCTATATGTGCGCTCATGTGAAG
TTGTGTGTTTGCTTACGACATCGATGATTTACTTGTAATGAATAGCGCGAGATTGAAGAGGAGAAGGGCAACTGCTTTGAAGGTGAGGAGCTCGAGGAGC
TCCACGCCAAGATGAACAAGATCTTCACCTTGAAGGAGACCCCTGGCAACATGGAGATCGTGCTGACCGGCCAGGTCGGCACCGACTCGATCCGCATCAA
GTTCGACTCGCAGGACGTGGTTGAGTTGGAAGAAGACTACGTCGATGAAGACGAAGAGGAGGAAGAGGAGGAAGCCAACTACGATGAGGAAGAAGAGGAA
GAGGACGGTGAAGAAGACGAGTTGCCTGGCATCCGCTTCGTCGCGGACGTCACCCGTGACAACCAGGGCCTCCAATTCGAATGCGTTGCCAGCAGCAACC
TAACCGTCGAGCGTGTGCGTTTCCTGAGCGATTTCTCGGCCAACGCCGAAAAGGACAACCTGTACTTTGGTCCAAACTTTGCCGACATGGAGTTGGACGT
GCAGGAAAAGTTCTACGACTACTTGGCCGAGCGCAAGATCGACGACGACTTGGCGCAATTCATTACCCAGTACGCAGACCTGAAAGAGCAGCGCGAGTAC
CTGTCCTTCTTGGAGAGCGCCGAGACGTTTATCAAGAACTAAGCAATAGAAACAACACACACGCACAGCCTCGGGGTTACTTGTACCGCATGTAGTAAGC
ACATAAACACACAAAAACAACGGTTTAACGCTAGCCTAACACACACAAAAACCTGGAGTTGTACTTGGTATGTCGCTTACAAAGCTAGCAATATCTCTTT
TTCTACCGCCGCGTCGTCACGCTGCTTCCGCCGTGGAATCGCGGGTGCTTTATTGCATTCTAGACATGACGTTCTGGAGAAGCTGCGAGACCTTGGGGTT
GGACATGTGGCGCATGGCGGCCGACGGACCTTCCGAGTCCACGTCACGGAAAAAGTCCTGCAGGTCCGGGTCCGATCGCGCCGCCATGAGCTCGGGGCTG
TTCATGAGGCGGCTCATATCAGGCATACCGCCAGCACCGCCACCTGCACCTGGAGAGGCGCCACCACCCATGCCGCCGAGGTTGTTCATCATGCTGCTGA
GCATTTCTGGGTTTTGCATCATGTTTTGCGCCCTGTTCGCGTCCAGGCACAACACAACACACATAAACACGCAGTCAGTTCACATCCTTCTCAGCCTCGA
GGGAAACTTTGCACGTACATTTGCATCATTTGAGGATTTTGCATCATGCTCGACGCCATTTGCTGAAGCGCCGGGTTGCTCATCAAATCGGCGAGCCCGC
CGCCGCCGCCGCCACCGCCGAGCATGCTAGCGAGGCCACTCAAGTCCGGCATGTCGCCAGCGGCGGCGCCGCCTGCTGGAGCTGCTGGCGCAGCGGTCGT
CTGCACTTGGCGACGCTTGCGTTCAGCTTCCGCGAGTCCGTCCTTGCAAGCCGCGTTTGTGCTGTCGACCTCCAAGCCGCGGCGGAACGCGTCAATTGCA
CCGTCAAAGTCCTTGAGCTGCACATACGCGTGGCCCATACGAGAGTATGCCTTCACATACGCAGGCTTCAGCGCAATCGACTTCTCCGAGTGGTCGATCA
CTTCGTCGTACTTGCCCAAGTACGTCAGCGCTGCCGCGAGGTTCGAGTGGTAGATGTGCGAGTTTGGACCAGCTGGTGACAGCTTGAGCGCTTCCTCATA
GTGCACAGCCGCTTGCTTGTAGTCTCCTGCGCTCAGCGCCAAGTTTCCTTTGCCCTTGGCCTCTTCAGCCTTGGCTTCCTTTTCTTCCTTCGACATAGAT
GGCTGCACACAAACATACGCAATTCACACGATCAATAACGTGCTCATCACCAAAAAAAGTCCAAACAGACTCGATGAAAGTACTTACCGCAGTAGGCGCT
GGCTTCTTGACGTCGCCAAATTTCTCCTTGAACTTGGCCAAGGCCTTCTTCAAGCGGGCCGTGTGCTCATCCGAACCCGCAGGTAAACCGTTGAAAAAAT
TCTTCTCTTCCAGCTTGGCAATCCACTTCTTCCACAGGTCAGGGTCTACAACGCACACACACAACGCAAGGCGGCGTAAGTGCGCAAACATACAGACTTG
CACTTCTACTCATAAAAGCGATACATCATCGTACTTTTCAAGACAACAGGGTCTTGGTCCACCGAGTCCAAAGGAGACGCCTACAAGCACGATGGGCAGT
CACAGTCAGCGCTTCCACAATGGAAAGAGGGCCCCCATACTTCGCCCAACACTCCATATGCAGTGCACGTACTGCGCCAATTTCAATGTTAAGCGCCTTC
AGCCCAGCCGCAAAGATGTCTTCGAACGTAGCTGAGCCGCTCAATGCGTACGTGCGCTTCTGCTGCTCATCGTGCACGTTCAATTTAAACGCCTCACTAC
ACACAGCCACAAGCAGCACACACAGTCGCATTCATTATGCAAAAGGCCAGGCACACAGAAAGCACATCAGTCATTTGTCCTTCTCCTCGCTCCCACGTGA
GCTTCCACTGCGTCCAGCGTGTCGTCAATTGTTTTGCCTAATACGGTGCACGTTCATGAAAAAAGCACGCACCTGAGGCACTGGACGCCGACCTCCACGT
TCTCGGTGTCGACCGCGTCGTCCTTCTTCTTGTTGTCGATCCACGCGAGCGCGTGGAAGAGCGCCGCCGCCTGCGTGGCCGCGTCCATGGCCATTTCGTT
CGTTCTCTCAGTCGAATATTCCAAAAGTGCCACGTTCCTCCCTTCCGTTCCCCCAAGCTATATTTTCAGCCAATCAAATACTTCGCTACATAATACCTCA
TTAATAGTGCGATGTGATTCGTTGAAAAGTACAACAGAATAAAAGATCGCGAAGAGCCACGATACCAAAATGCGCCAACATGGAGCCCCACCGGACGGGC
AGCGAGGACGACGAGGACGAGGCCGCGGGTACGAAGGTCGCGAACCTCGCGGCGCTCGAGCAGCGCAGGCACGAGGTCAAGAGCAAACTGCGCACGGTCG
TCAACTCACTGCGCGACGCGGGCGCCGTCACCAACGGCTACGACTCGGCGTACTTTCTCGAGCCGCTGCCGCCGGATTACCCGAGCGCATCCGTCCACGA
TCGGCTTTTCCATTGCCACAAGGTCCAAGCCTCACAGACATGGCTACGTCATGAGAAGCAGCTACGCTTTGAGTTCGACCCGCCAGACGAGTACCAGCTC
GAGTGGCGAATCTCAGCGCTCGGCAGAGAGAAATGCGCGATCGTGTTCGAGCGCTTTGACGTGGACGAGGATGGCGCATGGAGCTACAGCGAGTTCCTCG
AGTACCTCGCCGCGCTCGAGCAGGAGCGGGACCGACCAGATATCCGCGCGTTTGCGAGTGACCCAGAGGTCTGGCTCATGTACATGAGCGACCTCTTCGA
CATGGATGCGCATCTGCGACTCACGTTCCCGGGTTTCATCTTGTACCGCGAAGCCATTGAGCAAGACTCGCCGCTGGAAAATGACCTTCGTGTGCTCAAG
ATACCGATGGAATGGAAAGGACTGAAGAAGATGCGACGTTGTAGCCGCATCTTTGACGAGTACGCGGATACCGAGGGCGGTGTGGCCCTGAAGACTGCAC
AGTACCTCTTTGTCGAGGCTGGCCGCGCTCTCTCGTTCCACGAGCTCTGCGACACAATCCATCACCAGCGGTTGATGGCACGATGCTTCAAGTCTATTCT
GCAACCGAAGCACTCGCTTCGCCTCTTCGGATATCACCAGAAGATGCGTCTGCTGTACACAAACCCAATGTTGGATGAAGAACCAAAGATCTGCAAGCCT
GGGTTCCTGAGTCTCGTGCTGTCGTCGTGGACGCCTGCATCGAAGACAGTAAGCTGCCTCCCTTCGTATATGGGATGCTGTGCTTCAGGGTATCTGATGT
TATGTTTCCTTCCTGGTACAGCGCTGGCGGCAGTGGTTGATGCGCTCTCGACTGGTCGCATTCACGAAGTTGCGGCAGTGGCAGCGAGCTACGTCCTGGG
CGTTTGACAGCATTCGGCTCATCGCTCGCACTGGTCTTCTGCGCGCGAGCTGCCTGTTTTCACACAGTCCGCAGCAAGAAAGAGGTGACTATGTGTTCAA
GATGGACGTTGGCTCTCGGTTCTCAACCCATGCGACTATGCACGTGTCATACAACAGCGACGCCGACTGTAAGTAGCTCCTTGATGGTTTGATATGCTTG
CAACTCTAATATTCATGGCTTCTCCCACACACACGCACACACACGCACACACACTGCCAATAGCTGCTGCAACGCTCCATGAGTTGAAATACCTCGAGCG
AGGGGCTGAGTGCTTTGCATACGCCGATCTGGCGTGCCGAAGTGGCGCCAAAGGTAATGAATGTGTTTCCCATTGTTCATCTGCTTGGATGCATCTTTTT
GTGTGCTCACATCCGCTAACAATGTGGTTCGTTCGTTTAGACAATGATGTGCAGTGGATTACACAAAAATTGACGTGGTTTCTCCATGAATACTTTCGAG
ATCACTTGGAGAGTCTCCCGTTTTTCTACAAGTGGTTTGTCACGGTCCCGTCCAAGCTCCAGCTTCGCTCTGGTCCGACCAGCAGCGTTGGCACTGCGTC
TTCGTCGTCGGCGAGTGCGACGCCAGTCATCCGCATCGTCGTGCTGTTCTCGGGGGAAATGGATCTCTACCAGGTGATGCAGAGCCTGCACTTACCGTCG
TCGGTGCAGTTCAACCACTTGCTACAGCGCCTTTCGTTTCGGTGGCTCTGCAGCAATTCGCTGGAAGAGATCTTGACGAACAAGCGGCTCGTGCTCGGCT
CGCAATGGGCGTGTCGCGCGCAACTGGACACGCGGTTGAACAAGCAGGCATTTGCGCAGATCTTGTCTCAATTGGCGACGAAACTCGAAACGGATGCGGC
TCAAGAAGCCGAAGAGTTTGCGTGTTTTGCACGAGAGAAAGCAGCGTTCAATGGCGTATACCACGAGCAGCAACAGCAAGGCAGTAGTTCGCCCAAGAAA
GCCTCAGCGGTGTCTTCAAGCAACCAGAACGAGGCGACTGACAATGATGGGGATGACAAGTATCACCGTGTACACTTGTGGCTGCGCGATGCTGCCAATA
TGCTCAGCGCGTCACACGAAGTGAGCGCGACGTTTTCTTTTGCGAACCTGAACGACATGCTGCTAGGGAGCCGCTGGGTCGCGAGTGTGCTCCCGTCAAA
ACTGTACAGGCGCGTGAAGCATGTGCTCACGACGCCAGGAGGCGTTGCAGCCGAATGGAAAAGCGGATGCGATTCGTTTCGATCCGAGTTTGCATCTGCG
CGTCACTTCCAGGGAAGCAGTGGCGCTGGTGAAGGGAGTCGGACCTGGTCCCGAGCGTCATCACGGTCGTCCGCCCAGCTCACAGACGATTTCAACGCCA
TTAGTGATTTGGAGCACTCTATTGCCAGCGCATTTCCGTTCGCAACGCCGGTGTCGACGTCGGAAGCTTTGAAGCGCCCCGTTAATCCCACGAGTAACAA
CAACGCACGCGGTGGTGGCTCGTCGTCTCGTCCAGAGACTGGAGGTGGACAGCATGGAGCAGACGAACCGGGCGACAAGAAAGCGGAGTCGTTGACGAAA
GACGAGATCGCGGAGCGCGAGCTGCTGGAATTGTACGACATGTGCGCGAAGCACCTGATGGGCGTGAACGTGATCCGCGCCGAGGCCGGGACCAGTGGCA
TCACGTGCGTGCTCGAAGGGTGGAACTTTTTCAACCTCTTGCCCCGAGTGCAGAGCCATTTGGTCAAG