Description :
From Genome Similarity Track
Location :
Scaffold_1537:3496- 5797
Transcript NameFunction/comments
Phyta_totarag13212hypothetical protein

Sequence
2301 bases(100 bases per row)
AAGGGCATGAGCCCGGTTAATGCATGGACGGCGTTGTTGGTTGCAAATTCCACCATGGGGAGAAACGAGCTCCATGACTTGAACGACGTGGCGTTACTGC
GCAGCACATCCTCGAGGACGCGATTCACTCGTTTCGTCTGACCGTCCGTCTCCGGATGAGCTGCGGCGGACATCGGCAGCCGCGTGTCGAGAGTCTTGAA
AGGCTCCGACCAAATCGCAGCTCTGCATCGGGGATCTCGATCGGACTCGATCGAGGTCGGAAGTCCGTGATGTCGGTACACAACGGTGACGAAGATAGTC
GCCGTCGGTGCCGCAGTGATGGAGGTCGCCACGGGGAAAAatgcaccatcttgctgaatCTGTCGACGAGAACCAAGACGCCTGCATGACCAAAGGGCGT
CGCAAGGGAGGCCGAAGACGAAGTCCATGCTCGCCGAGCGCCACCCATCTGTCACGGCAGGAAGTGGCCGGAGCGGAGCTTGCCTCTACCGTATTGGCAT
GACGCGCTGGCACGCTTCACACGAGCGTACCCACTTTTTGACCCACTTGTACATGTGTGGCCAGTAAATTCGCGGGAGAGTACCGCGAAATTCTCCGAAG
TGTCCACCGCTTGGGGCATCATGAAACTCGTGATTCAagcgagcacgaagctcgtcgtccagtgGGATGATGATACGCGGACTGCCCGAGAGATCGACAC
GATTTGTTAGCAGGTCTCCGTCCCGCGCGTATCGCTCGATGCGTGCGCGACTCCGCGCAGAGAACTTGCGTCGCGCTGTATCTGACGGGTGGTACAGGTA
CTCCAACATCTCAGAGCAGGAAGCATCGTTGGCGTACGCGTCAGCAATGAGGTCGCGAAGGGGACTAGCTGCTGCAACCTCGACAGCGGCAACTTTCTCC
GCGACGCATACGGTAAACAAACCATCATCCCCGTCGCCAATGTGTGGAGACCGCTTGTCGTGTAAGGATCGTAGTCAGGACGTCGCGAAAGCGCGTTGGC
AAGGATGTTCGTCTTCCCCGGTTTGTAGTGGACTACGAAGTTGTACTCGGAAAACAGCGACAGCCAGCGCGCTATGCGCTGGGGCTCTTCATTGCTGGCG
AAAGGACGCGTGATCAGTGTATTGAGCGAATGTCTGCTCGCCTGAGAGGTAGGCGCGGTCTTTGATCAACACGTATCGTATCGCCAGGAGCTCCTTGTTG
TGGACATGATAGTTGAGCTTCGCCGACTTCATCTGACGCAACTGGTAGCTCACCACTCGTTCGCGTCCCTCGCCATCAAACTGCAACAGTGCGCAGCCGG
TCGCGAAGTCATTAGCATCGCACACCATGTGGAAGAGAATCGAGTGATCGGGAAGCATCAAGGTGGACAAGGTGTGCTTCACCGCGTCGAATGCAGCCTG
ATGTTCAGGACGCCACGACCACGTAACGTTGGATTTCAGTAGCTGTGACAGCGGAGGGGCCGCCGAAGCGAAGTTCTTCGAGTAGTGGTGGAGGTACATC
GTGAGGCCCAGCCACTGACGGAGTTGCTTCTGGTCCTGTGGTACTGATCACGCGCAGGTGGCTGCGGCCTTCTTTGGGTTAGCACGGGCACCGTCCTTGC
TGACGTATCTCCCGAGCACAGAGATCTCAggagcgaggaagaggcaTTTCGTCAAGGTGGCGGACAGTTTGTTGTCCTTCATCACTTGGAACACCTTTCG
GAGGTGTTGCAGATGCATCTTCATGTCGGCCATGCCGCTGTCACCACGACTATGGAAGAAGATGTTGCCAATGTAGCTCGGAGCGAAGTCTCGGGACGAG
CGCAGGGTGTGCGAGACCATGCGGTTGAAACTGGCAGGGGCGTTCTTCAACCTCTGTGGTATCGCGAGCTATTCCCACCGCATCCCACTAGGCGTGCTAA
CAGCAGTGAGCGGCACGTCATCTTTGCGCAGCATGATTCGATAGAACCCGTCCATCAAGTCGCTCGCACTGTAATTGGTACTACCTATATGCTGTCCAAC
ACCATGTACATGCGCGGAATCGACATCTGCGCTGGGATGGTGGCATCGTTGAGCTTATTGTAAGAGTGGAGGATCCGCCAGCCATCATCACGCAGAATTT
TCGGGCTGGCGTGTGGAGACAGGCTCTCACGGATATGGCCAGCCTGTCGTCGGCCCTCGATGATGGGACTACGGAGAAGCGACCACTGTCGCGTCACGCA
GTACTTCGCGCCGGGTGCGCGGTCGATCTCATGCCGCACTCGACGATCCGGTGGAAGCACAGCTGGGACCTTGTCCGAAAAAACTGATATGAACTCGTGT
A